Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3209  (registered. 2012)
Contig Information
Length 1424 bp
Clones alternative view 81 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 2
Wh_r Root 16
Wh_CSEC Callus 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_MS Seed DPA5 of DT3DL CS wheat 8
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 9
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XT Roots, 18 day old plants were grown hydroponically 9
WH_SP 2
WH_XA Root 2
WH_XB Root 4
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|40317416|gb|AAR84347.1|| glutamine synthetase isoform GSr1 [Triticum aestivum]
Score 738
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3209
TTTTTTTTTTAACAGAATCATAACCGGCTCCATGATTTCATTTATCGGAATGCGAAAACAACATTATTTTCAGAGTAGACTGAAGACTCTTACTCTTATC
TGAACGAGTAAAGTGAAAGACACCAAAGGCACGCCCCAAAAACAGACTAGACCTTGCAAAAGAAATGGAAACACGAAACGTTTTGCAGAAATTAATCAAT
CGCCACCCTCGATCGAGAGAGTCGAGAGCCTGGGTGTCATGATCTGGCGGCGGTAGGCATGGCCGTGGGTGGGTGGCTCAGAGGAGGAGCGTGGTCTCGG
CGATCATGGAGGTGACGACGTAGGGGTCCATGTTGGAGGCCGGCCTGCGGTCCTCGAAGTAGCCCTTGCCGTCCTTCTCGGTGTCGCGGCCCACGCGGAC
GGACGCGCCGCGGTCCGCCACGCCCCACTTGAAGGTGTTGATGTCGGCGGTCTCGTGGTGGCCCGTGAGGCGGCGCTCGTTGCCCTCGCCGTAGGCGGCG
ATGTGCTGCGCGTGCCGCTTGCCCAGCTTCTCGATGGCCGTCTTGATCACCTCGTACCCGCCGGCCTCCCGCATCGACTTGGTGCTGTAGTTGGTGTGCG
CGCCCGCGCCGTTCCAGTCGCCCGGGATCGGCTTCGGGTCCAGGGACAGCACCACCCCGGCAACCTCAGTGATCCTCTCGAGGATGTAGCGCGCCACCCA
CAGCTGGTCGGACGCCGCGATCCCGACGGACGGCCCAACTTGGAACTCCCACTGGCCGGGCATGACCTCCCCGTTGATGCCGCTGATGTTGATCCCGGCG
TAGAGGCAGGCCTTGTAGTGGGCGTCCACGATGTCACGCCCGAACGCCTTGTCCGCGCCGGCGGCGCAGTAGTATGGTCCCTGCGGACCAGGGTAGCCAC
CAATGGGCCAGCCAAGAGGCCAGTTCACGTCCTTCTGGAGGAGAGTGTACTCCTGCTCAATTCCATACCATGTCTCCTCAGCTGCAACCTTCGGGGTGTT
GAAGATCTTGGCAGCGTTGTGCCTCTTGTTCGTGGGGATTGGCACACCTTGGGGTGTGTAGCAGTCGCACATAACAAGGAGGTTGTCACCCCTCCTGAAC
GGGTCCTTGAAAATGGCCTGGGGGTAGAGGATGACTTCGCTGTCCTCTCCGGGAGCCTGGCCGGTGCTGGAGCCGTCGTAGTTCCACTTGGGCAGCTGGC
TCGCGTCGGTGATGGGGCCGTTCACCGTCCTTGCTTTGCTCCTGATGTCGATACCGGATCCTCCAACCCAGAGGTACTCGACGATGATCTTGTCGGTGCA
GTCGCTGAGGTCGAGGTTGACGAGGTCGGCGAGGCTGGCCATTGCTGCTGCTACTCGCAAGGAGGGAATGGCAATGTGGGGGAAGACTGAGATGAGATGA
GATGAGGTGTGCAGCTCCCTCGTG
page-top