Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32073  (registered. 2012)
Contig Information
Length 668 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_CSEC Callus 1
Wh_OKCS Seed DPA5 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|32400871|gb|AAP80667.1|AF479048_1|AF479048_1 ribosomal Pr 117 [Triticum aestivum]
Score 285
Evalue 3.00E-75
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32073
TTTTTTTTTTCCGATCAAAAGCTCTTTCAGGTTCAAACTCACCAAATCTCATCTCAGTAGCCAAACCACAGTGCAAAATCTTAAGAAAGCTAACAGACCA
TAATCCAGCAGCATTACATAATCCAGGAAACTCGTCCTCAAGTGCCACAAGTAATAAGCTAGAAGAAAAGAGGGACACGCTATCAAAGCTTTGATCATCT
AGCTGCTCCGGCGATCAGATCAGACGATGGCGTTCGCTGCGCTGGCGATCCTGGGCCACAGGTCGGCGCACTCCTTCCCAATCGGTCCAGTGATGGCAGA
ACCTTTCATCTCTCCCTTTGGGTTCACGATGACTCCAGCATTGTCTTCAAAGTACATGAAGACACCGTCCTTTCGGCGCCATGGCTTGCGCTGCCTGACT
ATGACAGCCGGCATGACCTTCTTCCTGAGGTCAGGCTTTCCCTTCTTGACAGTGGCCATAACCATGTCACCAACGCAGGCAGAAGGAAGCCTGTTGAGGC
GCCCCTTGATTCCCTTCACAGAGATGATGTAGAGGTTCTTGGCACCAGTGTTGTCGGCGCAGTTGACAGTGGCTGCCACCGGCAGACCCAGCGACATCCG
GAACTTGTTTCCAGCGGAACCTCCGCGCCCTCGCTTCGACATCTTGGAAGAAGAGGGGGCGGTACCCC
page-top