Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3203  (registered. 2012)
Contig Information
Length 690 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 2
Wh_r Root 1
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VWD Shoot grown with dessication 3
WH_XR Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig3203
TTTTTTTTTTTTTTTTTTATACAGTAGTACTATATGATTCAGAAGTTCTATAACCAGATATAAAATGGAACGTTTCCAATGGCCTGAGGCCCCGAGCAAC
ACAGATTAGCAGTCCAATGGTATGACCTCCATATAACTTAAACTCCACCAAGTACAATGGTAAGAGGTATAACAAGCATCACAAGAGTACCAGCTATCTC
ATTCAGTTCTAATTTTAAACCGACAACCAACTGCATATTGCAGCCCTATTCATCGTCACTATAAGCAGAGCACCACTCTACTCAGAAGAGACCGGCGTTT
GAGGCTGTCCTGATGATCTGGAACAGAGATGACCCAACAACAACGAAGACGAAAAATCCAAGCACGATAGGTCCAACAGGATAATCATTTCCTTTCTTGA
CTGTCTCGGGAACAGAACCCCTCTTAGTGATATTCTTCTCAAATACTGCAATTTTCCTATCAGCAACACGTCTTGAGGTAGTCATGGCGACGACGACGAC
GGCGGGTCGCCGACAGCCGGGACGCGACTGAAGACGGGGAGGGTCAGAGGAGTGTAGGGGGTCCCTGCGGAGGAATTTGGGAGACGGCGACGGGGGGTCC
GAGACCACCGGTCGGTCGGCCTTTTATTATGCGCGCCGGGGCCGGACCTCTCTCGCGTTTCCCGTGGGCTACCTGCGGCGGCCCTCGTGC
page-top