Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig32008  (registered. 2012)
Contig Information
Length 636 bp
Clones alternative view 48 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 6
Wh_e Seed DPA10 2
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 5
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_CA 1
WH_SP 6
WH_XA Root 1
WH_XB Root 1
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|122022|sp|P27807.3|H2B1_WHEAT|H2B1_WHEAT RecName: Full=Histone H2B.1
Score 277
Evalue 7.00E-73
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig32008
TTTTTTTTTTCACTGAACATTGAGGCAGGCACCGTTACTATTTCTCGAGATCCAGAAACATAGCGATGCGATTCTTACACGATAACACGGCCACAAACAC
ACCCAAACAGCTAACTACGAGACTCAGGAGGAGGTGAACTTGGTGACAGCCTTGGTGCCCTCGGAGACGGCGTGCTTGGCGAGCTCGCCGGGGAGGACGA
GGCGGACGGAGGTCTGGATCTCCCGGGACGTGATGGTGGGCTTCTTGTTGTACCTCGCCAGCTTAGCGGCCTCGCCGGCGAGCTTCTCGAAGATGTCGTT
GATGAAGGAGTTCATGATGGACATGGCCTTGGAGGAGATGCCGATGTCGGGGTGCACCTGCTTCAGCACCTTGAAGATGTAGATCTTGTACGTCTCCACG
CTCTTCTTGGCCTTCTTCTTCGCCTTGCCGCCCTCCTTGGCCGCCGCCGACGACTTGCCCGCCGGCAGCCGCTTCTCGGCCTTGGGCTTCTTCCCGGCCG
GGGTCTTCTCGGCCTTCTCCGCCGCGGGCTCCTCCTCCACTGGCTTCTTCGCCGCCGGCTTCTTCTCGGCCTTGGGCGCCATGGATGCTGACGGTGGGGT
GGGGCGGGGTGGGGTTTCGCTGGAGGATTGAAGGAG
page-top