Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3194  (registered. 2012)
Contig Information
Length 998 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XF Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242082472|ref|XP_002441661.1|| hypothetical protein SORBIDRAFT_08g000400 [Sorghum bicolor]
Score 293
Evalue 3.00E-77
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3194
GAAGAGCTGAAGGAAAACGAAATAAGTCGTGAAGAAATGGTGAAGAAGATGATAATAATAGTCGGAGAAAAGTTACTTTTGGAAACTTTAAAGAAACTCC
ATTACTGTCCATCACTATGGCATAAATCTTCTGTCGAAGTGATGTCCAGTGATCCTGCAAGGGTAGCAGCAGAAGATCCTGCAAGGACAACAGAAGAACA
CATATCCTTGGATAAAACAACTGGGCATTGTGCACTAACTCTTGGTAACCTTGGCGATTCCTGTGGACCAAATACATTGGCTGAAAGTTCCACAGCTCTT
AGCACCAAAGGATGTGATACTCTTGCAGTAGCTACGGTGCCCAAAAGCCATGATTCTGTCGCACCAAGCAGTGTGCCTGAAACATCTACTTCTTCTGGTG
CCATATGCCTAGCTTCCCCAAGTGTGAAACCCAAAAGTAGGGATTCTCCTATACGAATAATGTCACCTGAAAGCTCTGCAAATCATGGTGCCAAAAATCA
GGATCCTTCTGCAGCTAGAATGGCACCTACACTTCATAACGTCCTTCTGAGGACAGCTTCTGGAAAATCTGCATCTCATGGTTATGCTTCTCCAGCACCA
AGTAATGCCTCAAAAGGCCGTGGGATTAGTGCTCCAGGACTCAGTCTGAAGGGCTCTGAATGTCCTGGGCCAGTTTTGGCACTGGGAAGCACCAAATTCA
GAGGGATGAAAAGTCCCAGCTCTGTGCCAAGAATGACACCTGAAGGCCCGGAATTTCTTTCACTGAGTATTGCACCACAAAGCAAAGCAATTTATCCAAC
TAAGTGCCATGGTGGTGATTCGATTTCTTCTGTCGCAGCTCCAGCTCATGTGCCAGGACATGTGAACTCTTCAGCTTTGAGCGCTGAAGGCTGCGATTCT
CTAGCACTGAGTATCGCGCCAAACTGCCATGATCCTCCAGCATCAAGCAACAACGAGCCAGCGCTCCATGGGGCTCCAACAACACATACAGCATCTGA
page-top