Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig31935  (registered. 2012)
Contig Information
Length 887 bp
Clones alternative view 66 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 4
Wh_e Seed DPA10 1
Wh_h Spike at heading date 6
Wh_yd Spikelet at late flowering 6
Wh_EM Dormant seed with water absorption 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 3
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VSCB Liquid cultured tissue 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 7
WH_XB Root 6
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|18266636|gb|AAL67582.1|AC018929_4|AC018929_4 unknown protein [Oryza sativa Japonica Group]
Score 213
Evalue 2.00E-53
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig31935
TTTTTTTTTTAAATAGAAAGAACTCGTACAGCACAGCAAGAGCCGTCTTTCGTACAGTTGTAAACTCAAGATGCAAAGGCAAGGGCAGCTAAACATCATT
TGTATAAATGAAACTGGAAACAAGGTAGGTAAGTCCAAGCAACGATTTGCTTAACTCCTTCAAGTTAACAAAAAAAAATACAGACACCACACAACAATGT
TTGCTTCGCATCATCATTTATTAAATGCCTATCAGCAACTTCAGAGGTAAGAGAGGAGCTGCGGCAGTTCAAGTTACTTCACTTCGAATGGAAAGATGAC
CTCTCCATTCCAGGAATGGCGGCGGAAGCAACCGTGCTAGTCCTCGACCTCGACCACCTTCTTGGGCTCGTGGAGGTCCGCCGGGCGGTGGTCCTTGCCC
CACCCGACGCCGCGGGTGGACTCGAGGTACTGGTCGACGAGGTGGCGGCACTTCTGGTGGTGGTTGACGCCCTCGATCCGGTAGCACCAGCGGAGGCGGT
CGCGGATGATCTTGGCGGTCTCGATCTGGATCCACTTCTCCCGCACCAGGTGCTCCCTGTACTCCAGCATCGCCACCGGGTCCCCGTACGGGTTCTTCGG
GTCGAAGTCATCCGGCGGCCTCTCGTCGAACTCGACCTTGGCCTTCCGCACCATCTCCGATCGCCTGCTCCGCCGCCGCCGCCGGCCTCTCTCTCTCCTC
CCTTCTCTTCTTGGCCTCTAGGGTGGATGGATCTCGTCGTGGGGAATTCGGCACGAGGCGACGAGCCCGGCTCCCGAAGGAGAACTCGAACTCGTCGTCG
GACTCGTCGGCGGGAATCGGGGGGCCATCCGCCCTGGCGACCATGGGCTCCTGGCGTCGGCTGTCACTGCGCCGCTCCTCCATGTCT
page-top