Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3192  (registered. 2012)
Contig Information
Length 718 bp
Clones alternative view 50 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 3
Wh_h Spike at heading date 2
Wh_r Root 2
Wh_CSEC Callus 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_PCDAM Anther at meiosis 1
Wh_SHC Shoot grown with cold treatment 1
Wh_VWD Shoot grown with dessication 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 1
WH_XA Root 8
WH_XB Root 6
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XE Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|110590380|pdb|2GO5|6|6 Chain 6, Structure Of Signal Recognition Particle Receptor (Sr) In"
Score 247
Evalue 1.00E-63
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3192
CTGCCCAGTCAGCTAGTTCCATGAAATGGTACCGTCGTAGTGCTAGTAGATGTCCACAAAGATCAAAACCCTCCTCAAGCAACTTCATTGTGAAGCTGCT
AACATATTTATATTGAAGCAGAATTTTTTTTTTTTTATCCAACGTCTCAAATCTTCTATCAAGAAGTCATGGAACATCATGAACAGTAGATAACAATAAG
CTAAAGCAAGACTTCCCAATATGCTCTCAGCAGATATGTATTAAGTTCTAACTGATCGATACGACAGACAGGGGGTTTAGTCCTCATCCTCCACAACCTT
GGTACCCAAACCTTTAAGACCTTCCTGGGGGACTTCAGCAACTGTGACCAGAGAGTACAGCTCCTCCTTAGCATCCTCCTCGTCGTTCCTCTTGCGGGCA
ATCCTGACACGGACTCTCCTAGGGACACTCCTGATGCCGCTGCTCCAGATGTGCTTGTTGAGCTTCACGTCAATGCGGACATCGTTGGTTCCCATGGCCT
TCTGTGCAAACTTCCTGATCTCCTTGATGGCATTTGGTGCCTTCTTCTTGAAGGTGCATCCATGGAGGCGCTTGTGGAGGTTGACGGTGTACTCGCGGGT
CACCACCTCGTCCTTGCGCGGGCCGGGGGCGCGCTTCTTCTCCGACATCTCCGACGGCCTCCTTTCGCCCTGCTCCTCTCTTGGCTTCGGTGGAGGCTGC
GGCGATAGGACCTCGTGC
page-top