Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig31903  (registered. 2012)
Contig Information
Length 1326 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_RDr Root of dessiccated seed 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222630284|gb|EEE62416.1|| hypothetical protein OsJ_17207 [Oryza sativa Japonica Group]
Score 795
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig31903
GTGCTGCTGCGGCGGCCCCACGCGGCGGCGTGGGCGTCCGCGTGCCGGGGGTACGCGGCGTCGGGGGAGGAGAGCGACGTCGTCGTGATCGGCGGCGGGC
CCGGTGGGTACGTGGCGGCCATCAAGGCGGCGCAGCTCGGTCTTAAGACCACCTGCATCGAGAAGAGGGGCGCGCTCGGGGGGACCTGCCTCAACGTCGG
CTGCATCCCGTCCAAGGCTCTTCTGCATTCGTCGCATATGTACCATGAGGCAAAGTCTTCTTTTGCACACCATGGCGTTAAGTTCTCCAATCTGGAGGTA
GATCTGCCTGCAATGATGGCTCAGAAAGACAAGGCTGTTTCTGGGCTTACAAAGGGCATCGAAGGCCTGTTCAAGAAGAACAAGGTTGAGTATGTTAAAG
GGTTTGGGAAGCTTGTCTCTCCGTCAGAGGTATCTGTGGATTTAGTTGATGGTGGTAGCACTATCGTCAAAGGGAAGAACATAATTGTCGCCACTGGCTC
AGATGTGAAATCTCTCCCTGGAGTTACAATTGATGAGAAGAAGATTGTGTCATCTACTGGGGCTCTTGCACTTACAGAAATACCAAAGAAGTTGGTGGTC
ATTGGAGCTGGATACATAGGTCTAGAGATGGGTTCTGTCTGGAACAGGCTAGGGTCTGAAGTGACTGTGGTTGAATTTGCCCCTGATATTGTCCCATCAA
TGGATGGAGAGATAAGGAAGCAGTTTCAGCGTATGCTGGAGAAGCAAAAGTTTAAGTTCATGCTCAAGACAAAGGTAGTCGGGGTCGATACTTCTGGAAG
TGGTGTCAAGTTAACTGTGGAGCCTGCAGCTGGTGGAGAGCAGACTGTCATTGAGGCTGATGTTGTCCTTGTATCTGCTGGCAGAGTCCCATACACTGCT
GGTATTGGGCTGGACGCCATTGGTGTTGAGACAGACAAGGGCGGAAGGGTCCTTGTTGACAATCGCTTTATGACAAATGTTAAGGGCGTATACGCGATTG
GAGATGCGATACCTGGACCGATGCTTGCACACAAGGCTGAGGAGGATGGTGTTGCATGTGTTGAATTTATCGCGGGGAAGGAGGGCCATGTTGACTATGA
CACTGTACCTGGCGTGGTGTACACACACCCAGAGGTGNNNTCCGTTGGCAAGACGGAGGAACAGGTCAAGGCATCTGGTGTAGCCTANNNNGTTGGGAAG
TTCCCCCTGCTGGCAAACAGTCGGGCGAAGGCAATCGATGATGCCGAANNGATGGTGAAGGTGATATCTGAGAAGGAAACTGATAGAATNNNNNNCGTAC
ACATAATGTCCCCTGGCGCGGGCGAG
page-top