Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3183  (registered. 2012)
Contig Information
Length 763 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 2
Wh_EM Dormant seed with water absorption 1
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_SHDr Shoot grown with dessication 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115458618|ref|NP_001052909.1|| Os04g0446300 [Oryza sativa (japonica cultivar-group)]
Score 348
Evalue 3.00E-94
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3183
TCCTCGCCCTCGACGACGGAGCAGATGGCGAGCGACGGCGCGGTGGCCACGCCGGCGAAGGTGACCCCGAAGAAGGCCAACCTCCTTGACCCCCACTCCA
TCAAACACCTCCTCGACGAGACCGTCGCCGAGGTCGTGAAGGGGAAGGGCTATGTGGAGAACACGCGGCTGGGCAATTGGAAGCTCCTGATCGGGACGGC
GGTGATCGCCATCGCGCTCCTCGCGCAGTTCTACCCGAAGAAGTTCCCGCAGAACCGCGAGTTCCTGCTCGGTTGCATCGCGCTGTATGTGGTGATGAAT
GTGGTGCTGCTGATCCTTAGCTACACCAAGGAGAAGGATGCCATCATCTTCACCCACTCTCCTGCTGGTTCTTTCAATAACACTGGCCTTGTTATATCTT
CAAAGTTACCAAGATTCTCAGACATGTACAATCTTTCAATAGCCAGCGCGGATCCAGAGTCTATCTCTGCTCACAAGCCTGTCCACTTCACTAAGAGTGT
TACAAAATGGTTTACGAAGGAAGGTGTTCTTGTGGAGGGCCTGTTCTGGAAGGATGTTGAGAGACTGATTGATGACTACAACAATGAGCGCAAGAGCAAA
TGAATTACTGACCCTTGTCATCATTATCAGGATGAAGCTTAGTAATCGAAATAGACAATGTTTTTTATAGCAGTATACTGTTTGAACCGGCGAATGAAGG
ATTGTTAAGATAATATACATCATTGCAGTCTTTTTTCCCTTGGTATACAGGTCTATCTATGCG
page-top