Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig31811  (registered. 2012)
Contig Information
Length 1014 bp
Clones alternative view 55 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 5
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 7
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 6
Wh_SHC Shoot grown with cold treatment 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 9
WH_XN Leaves, plant was grown at constant 23 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|88687741|dbj|BAE79815.1|| sucrose synthase [Lolium perenne]
Score 511
Evalue 7.00E-154
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig31811
TTTTTTTTTTGAGACAGACAACGAAACATTGCATTGAACTCTGATGAAAGATGAACAATATGGGCAGGCGTTTATTCCACGCAACAAATGCGGCTGGCAT
GAACCAGCGAGCACTGCCCAGGACCTCACAAATGTGCCGAGACAACAAATTAACACACCCCACGACCAGACCAAATGGAAACTACGGTAGACAGACAAAT
CATAACGCAGCCGACACTTCACCCTCCCGCTGAATGCGCCTCTTCATGCCCCATTGCACCGCGCTAGTTGTCGGAGCTCTCGCCATCAACTGCCAATGGA
ACTGCAGCAGCCAGGCTGCGGTACTTCAGAGCGTAGAACATCTCCAGGTAACGGCGAGTCTCGCGCCTCTCCAGGTTGCTCACGTACTTCCAGAACCCAT
ACACGCCGGTCAGGGTCATCAGCCTCTCTGAGTACAGCTTCCAGGTGTACTTCTCATAAATTCTCTTCAGGCCTCCTTCAGACATTTTGTCCCAGTAGCT
TGGATCCTCGCTGCACTTCTCAAAGAAGTTGACCAGGATATCTGCGGCCTTGTCGCTGTGGTAAGGATCAATGTGCAGGCCAGACACCCCGTTCACAATG
ATTTCAGCAGGGCCACCGTGGCATGTCGCAATTGTCGGCAAACCACATGTCATGGCCTCAATGACAGTCAGGCCAAATGCTTCATAGAATGCAGGCTGCA
CAAATGCTCCCTTGGTGTCACAGATGTAGCGGTACAGCTCACCATTGCGAACACGGTTCATCTGAGCAGAGATCCAACGGATATGGCCCTTCAGCTTGTA
CTCCTCAATGAGACTGTACATCCTCTTGAACTCAGCCTGCTCCTCCCTATCCTTGGACTCCTTGCCATGGTCACCAGCAACAATCACAAGGTTTGCCAAA
TCCTTCAGATGAGCATTCTTGCCGTACATCTCAACCAAGCCAGTCATGTTCTTCACACGGTCAAGACGGGCCATTGAAAAGATGATTGGCTTGTTCCTGT
CCTTCAACACAAAT
page-top