Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3174  (registered. 2012)
Contig Information
Length 907 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_VSCB Liquid cultured tissue 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|212722800|ref|NP_001132429.1|| hypothetical protein LOC100193880 [Zea mays]
Score 251
Evalue 1.00E-64
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3174
AAACCCTAACCCGCCGCCACGCCGCCCTCCCTCCACCCGCGCCGGCGCCGCTTCTCCCCACCGATACAGGCCAAACCCCTCGCGCGGGGGCATCGGAGGC
GGAGGAGGGATGTCGTCCGACGGGGACAACAAGCGGCTGTTCCGCGCACGGCGCACGGCGCTACAGATGTTGGCAGACCGCGGGTACAAGGTGAAGGACG
ACGAAATCAAGCTGTCCCTGTACGAGTTCGTCGAGCGCTACGGAGACCCCGTCCGCCGCGACGAGATCGTCATCCATTGCGAGAAGAAGGGCGAGCCCAA
CGACAAGGTCAACGTCTTCTTCCTCGACGAGTCCAAGACCGGCCTGGCCGTGGTCAGGAGCTGCGTCGAGAAGATGAAGCTGGGGAACGCCACCAATGGC
ATACTCGTCCTGCAGAAGGCGCTGAGCGGCCCGGCCCGGACCGAGGTCGCGCAGAGCAAGAAGTACCACCTCGAGGTCTTCCAGGAAGGGGAGCTTCTTG
TAAACATTACTGAACACCATCTCGTTCCGAAGCACGAGCTCCTGAGTGACGAGGAGAAGAAGGAGCTGCTGCAGAAATACACTGCCCACGAAACTCAGCT
CCCCAGGATTCAGCTCACGGATCCGGTAGCAAGATACTACGGCATGAAGCGTGGGCAGGTGGTGAAGATCACCCGGCAGAGCGAAGTTGCCGGACAATAC
GTGACCTACCGCTACGTCATCTGATCCTCACCAACGTATCAAGGCTTGAGGTTGGTCTGGGAATTAAAATGGTTCCTTCGTCGCCAAACCCTCCCAGTAC
CAGAAAGAAGCATTGCTGTGTGTGTGGAGGAACCAAGGTGCTCGCTGAAGTGGCTAGGTGCCCCTTTGTACCTTCCTGGCAATTTGACATGAAGTGGCTA
GGTGCTC
page-top