Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig31717  (registered. 2012)
Contig Information
Length 872 bp
Clones alternative view 64 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 8
Wh_dL Crown of seedling 7
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_SP 2
WH_XA Root 2
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 8
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|119638443|gb|ABL85034.1|| ribosomal subunit 8E protein [Brachypodium sylvaticum]
Score 411
Evalue 4.00E-113
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig31717
CACAACCAAAACAGGAAAAACATTCTCAGTTCAACCTAGGACTCGAACAGTTTACAGAAAATGGTGTTCAGTATGTCTGCAAACATGACATGGACGCAAC
ATCTAAGAAAATCCAACAAGTAACATGCAGCAGCTCTTCAGCCTAAGCTGTGGCACCCTTGCCCTTCTTCTTCTGGAGCTTCCTCATGTAGAACTCCAGC
TCCTTGCCCTCCAGGATGTACCCATCAGCTCTGCCACACTGTCCAGGGCGAGACGAAATGCAGGCCAGCAGCCTTCCACCGCTGAACTGCTCCTCAATGT
GAGAGTCCAGTGTACGTCCCTGCTGGCGCTTCTCAAGCTTCCTCTGGACATTGTTGCTCTTCTTTGCTTCCTCTGTGGCAGCAGCAGCAACCTCAGACTC
TTGTCCCTCAGCAGCATCCTTCTTGGCAGCTGCAGCAGCTTTCTTCTTCCTACCGATTTCCACTCCATAATGAGTCAGGTACCACTGCTTGAAAGGGGCA
GCATCAACTTGCACAATGGCATTCTTGACAAGGGTCTGAGTCCTCACAAGCTCATTGTTTGACGAATTGTAAACCACATCCAGGAGACGGGTCTTGCGGG
TCACCGCCTCACTACCCCATGAGAAGTTACCAGTGTCCAGACGGAGAGCCCTCCACTTCACGTTACCTCCACGAACACGGACCCTCCTCACTGTCTTGTT
GCTCGAAAGCTTAGTGTTGGCTGGCTGGCGGCCGAGCTCATACTTTCGCTTCTTCCTCCACGCCTTCTGCTTCCCACCGGTGGCCCGGCGCTTGTGCATG
GAGTCACGCGAGATACCCATGGTGGCGTCGGTGGCTTGGCTCCGCTGCTGCTTCGCCTCCTATGCGCGCGCC
page-top