Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3169  (registered. 2012)
Contig Information
Length 597 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_PCDAM Anther at meiosis 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig3169
GATCCGCGCCGCAGCTGCCCCCCTGCTCTCCTCCACCAGAGCAGCGCCGCCAGCCGACGCCCTCCCTCTCTTCTCCATCCGTCCATCCCTCGTCGAGCCA
AGCTGGGAGTGCTGCGGGGGGATCTCGGGGATGTTAATCGGCGACCAATCTTCGGCCGAATCAAGATAGAAACAGGTTTTGATACTGAAGTGGGAGAGTG
GTATAGTCTGTTTGAGTATAACATTTATTTTCAGAAGAAACCACTTCTCCACATGGCGGGGGCTGAATCCGCATTACCTGCCGTAGATCATGTGGTGCTG
GATAATAGCGACACTGAAGTCTCAGAAGTCGTGGAATGTGATTCCACAGTTGTAGATGTGCTGAAGAAGAGTGCCAGTAAAGAATTTGGTTTGCAACTTC
CCTTGGGAAACAAGGAAGACATAGAATCCCTTGGCACAGTTTGTGATCTTGAGAATAACGAGGGTAATGTTGCTGAGGCAACCACTCTGAATGTGGTTGC
ACTAGAAATGTCCATCTCTAGCAAGGTTTCAGATGAAAGTATTTCACTGGGCTGTCAAACACCANNNGGAAACATCTTTGACCCCTTTGCTCCAGGA
page-top