Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig31652  (registered. 2012)
Contig Information
Length 1636 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 2
Wh_h Spike at heading date 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_SHDr Shoot grown with dessication 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218197330|gb|EEC79757.1|| hypothetical protein OsI_21141 [Oryza sativa Indica Group]
Score 635
Evalue 5.00E-180
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig31652
CAGATTTTGCGCACTTGACATTCGGTAGTTTTGTGTCTGGGACACTTGATGCGCCATGCTCCATGATGCCTGCCAATAGTGACGTGGAGGTCGCAGCAGT
TCCTGATAACCAGTCAGGGGACCAATGTGATGCCAGAATCCACGAATTTGAAAACAAGGAGACAGTAACTCCTGCAGCCAACGAGTACATTGCTTCTGCA
CCAGATAGTAATGCAGAGAATCCTGATATTACATCAGCACAACAGTCTGAAGTGGGAAGAGCTGATTCACTGGATGTTACAAACAACACCGAATACAATT
TATCATCTGATTATGCCACGTCAAGTGCAGTACAACCAGAGCCTACCGTGCAGACTTATCTGCAGGACAATCGTCAAATGCAAAACATTTCTCCCCTCTC
TAACTTCATGCAAGGAAATATGCCAAATGGCCTATTGCCACCAGCAATACCGCCTTTCCGTGAGTTGGATCCAGCATTCTCGCTGCTGCTTACTAACCCT
CCATTGGCTACAATGGTTCATGGTACACCACAATCGTCCGTGAACAATGCAACTGTTCCTTCACAGCCACAAGAGAATGTTAATCAAGGTGGTTTATCCA
ACCCACAGTTGACCCACTCTCAGGGAAGCACCGGCATTGCTCCAGGTCCTCCTTTGCCTCACCATCTTGCTGCGCTTCATCCTTATGCTCAAGGAGGTCT
TCCCCTTGGATATGCAAGCATGATCGGATACCCATCTTTACCGCAAAGCTATGCGTATCTCCCGCCTGCTGCCTATCAGCAACCATACATGAACAGCGGT
CTATTCCACCAAGGCGCAGCTGCAGCTCCCAACTCGGGCGTAAAATACCCAATGCCACAATACAAGAGCAGTGTTCCTCTTGGGAGCCTTCCACAGCCAG
CCTCGATGCTCTCCAACTACGTTGGAGGTTTCGGGACTGCAAATGGCATGCCTCAAAACTTTGCCCTGAACCAAAGCAATCCGTCGGCAACCACAGCTCC
TGGGTTTGATGGAGCAATGCCCTCCCAATACAAGGATGGAAACCCCTACATGTCTCTACAGCAGGGCGAGAACCCTGCAATGTGGATGCATGGAGCTGGT
TCGCGAGGAATGCCGCCTCTTGCTGCCAACCCCTTGTATGGCTATCAAGGGCAGCAAGGCTACCAGGGGCAGCAGGGCCATCAGGGCGGCCTTAGGCAGG
GGCAGATGCCGTCGCAGTACGGCGCAGCGCTCGGGCAGTCGCAGCCAGGCCTAGGACCTGAACACCGAAACCCCAGCGACGGAAACTTGAGTGCTGCCGC
CGCCGCCCAGGCTAACCAAATGTGGCCGAATGGCTACTGATTCAGCACCCCCCCTTGTCAGCTGTCCTGAATAGAGATATAGAGTTGGTAGCTACTGTGA
AATTTTGGAAAGAGGCCCGTGAGATGTGTTCCAACATGTTCAACCTGTAGTGTTTCCTAGGGACCTCGGCTGTAGCTCAACTTGTTTATTTTCAGATCAG
ATAGAAAAGAACGGTTTATTGTCTGTCTGTCTGTTTGTTCTTTTTTTCTTTCTGTCGTTTATTACATATATTGTGTAACAATAAACCAGAAAATATCTAT
CTAACAAAGCAGCACCATTAACTTTTAAAAAAAAAA
page-top