Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3165  (registered. 2012)
Contig Information
Length 611 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125528620|gb|EAY76734.1|| hypothetical protein OsI_04689 [Oryza sativa Indica Group]
Score 238
Evalue 4.00E-61
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3165
TACAGCATTACATTCATTTTACAACAAATGTTGTCCAAGCAAAAGAAAGAATGCAAGGCCGCCCTCGCTTGGCGCGGAAAAAAAAACACATACATGATTC
TACAGCTGCACAATGCTTTTGCCTTTTTCAGCATCAACAAGAATCATATGCTTATATCTAGAGCCAAAATTCAGTCTAGTGTAATACGTGCCCACTAACC
GGGAACAGTTTTGCGTCGAATGTATATTTCACTACATGCTTGCTTCGATCTCCTTGGGCCGCCACGTGGTCTTTTGGACGCAGAGCAGCCCTTCCTTGTC
CTTGGCGTAGGTCATGCGCACCTCCCACTGCAGGGACTTCGCCATGCCTTCGAGCTCGCTTATTGTCTCCGCGTTGTCCCTCACGATCAGTTTGCCTTCT
GGCCGCAATATCCGGTCAACCTCGGCAAACACTCCCAACAATTTACATCTCTTTTTGAGCTTTGAGAACAGATGGTCTGCATGTAGGAGATCATATGTTC
TCGGGTAAGTGCTGAAAGATTCGCACCAGTCATGATACATTCCAAACAAGCCACGCTCATAAACAATTGGCAGTGTGTCAGGTGAATCGATTGGCACGAT
ATTCATAACCC
page-top