Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3164  (registered. 2012)
Contig Information
Length 1128 bp
Clones alternative view 33 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_SH - 2
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 5
Wh_VHS Shoot with heat shock treatment 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 6
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23Ž 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115472897|ref|NP_001060047.1|| Os07g0570700 [Oryza sativa (japonica cultivar-group)]
Score 427
Evalue 1.00E-117
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3164
TTTTTTTTTTAGCAAAGGAAAACTGAAAATAACTTTTAGAGTGCACATCACAGAATTTAATTCATGGAAATATTGACAATGGCAGTCGGACAGGAAGACG
GGGAAGGCCTAATTACAAAAGGGAAAGGAGGGACGCAGCAACACTGTCTCAACTTTGCATCCATCAGTCTTAGCGAGACTCCAACAACCCAACGAGTGCA
CCCCATCGCACTGGCAGCCATCCGATGACCAGAGGAGGGCTTCAGAAAACATGTAGCCAGTTTTTGTTCAGTCGGAGTCGGGTCTGGATCTAAACCTTGC
TCAGCTCCTGTTCCTTTTGCTTTTGGATGGCTTCAACCTTCTTCATGTACTCGTCTGTGATTTTTTGTAGATCGGCTGATAAATCCTTCACATTATCTTC
AGAAAGTTTCTTTTCCTTCTCTAGCTTATCGTAGGCTTTGATTGCATCTCGTCTTATGTTTCTGATAGCAACCTTGCCTTCTTCAGATAACTTGGCTACG
GTTTTTGTCATTTCCTTTCTGCGGTCAGATGTCAATGGTGGGACAGTGACTCGTATCACTTCTCCATCATTGCTTGGTGTTACCCCAATATTTGCAGCAA
CTATAGCTTTCTCAATGAGCTTGAGGCAAGACTTGTCATATGGTTGGATAAGAAGAGAAGTCGCATCTGGGGTATTTATCTGTGCAATAGTCTTCAAGTT
TACAGGAGTTCCATAGTACTCAACCTCAATCCTGTCGAGCATAGACGGGTTTGCCCGCCCAGTCCTGACGGTATTGAAGTTCGATTGAACTGTTTCAATG
GCCTTCTCCATCTTTTCTTTAGCTTGTTCTTCAACGATCATCTTTTCTTCCTCAATTTCTTCATTAGTGGCATGCCTCAAAACTGCTCTCTTGTCCGAGT
GTTGAAGAACCAAAGGCACACCAAAGAAACCCACTGCTCCAGAATGAAATTTCATGAAGTTTGTGGACGAACTTAACAGGGATGAACGGTTTGAGAGACA
ACCACAACCTGGGCGCTGGGGCAGACGGGCAGAGGAGAGGGCGCAGGGCGGGGAGGCCGCCGCCGCAGGGGAGACGGCGTGGAGCGCCATGGCGCGGCAG
CAGGCGGAGTGGTAGCGAGGGGAAGGCC
page-top