Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig31630  (registered. 2012)
Contig Information
Length 1285 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222616518|gb|EEE52650.1|| hypothetical protein OsJ_35012 [Oryza sativa Japonica Group]
Score 652
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig31630
GTCGCTGGAGCCGGACGCGGAGGAGGAATGGGCAGCGGTGGAGCGGCGAGGCGCTCACCTGGTAACGAGGGCGGCGGAGCGCCCCTTCATCATCCACGGG
TTCAACACCTACTGGCTCATGTCCTTCGCCGCCGACGAGGCCACGCGGCCGCGCGTGACCGCGGCCATTGCCGAGGCTGCCGGGGCGGGGCTCAACGTGT
GCCGCACCTGGGCGTTCGCTGACGGAGGGTACCACGCGCTGCAGACCGCGCCATTCTGCTACGACGAGGTGGTGTTCCAGGCACTAGATTTCGTGGTCAG
CGAGGCAAGAAGGTATAAGATGCGGTTAATACTGTCACTTTGTAATAACTGGGAAGATTATGGAGGGAAGGCACAGTATGTAAGATGGGGTAAGGAGGCT
GGCGTAGATCTTACTTCTGACGACGACTTCTTCTCTGGTCCAACACTTAAAGGGTACTACAAAGCTTTTGTTGAGGCTGTTTTGTCAAGAATAAACACAA
TCACAAATGAGGCCTACAAAGATGATCCTACTATTCTTGCCTGGGAGCTGATTAACGAGCCGCGCTGCCCTTCAGATCCATCAGGCGATACGCTGCAGGC
ATGGATAGAAGAGATGGCTTCTTACGTGAAGTCTATAGATACTATGCACCTCGTGGAGATTGGTATTGAAGGGTATTATGGTCCGTCTACTCCAGAACTT
TTGCTCGTCAACCCAGATGATTATTCAGGGCATGTTGGAACGGACTTCATCAGGAACCATCAAGCAATGGGAATTGATTTAGCTTCAGTTCATATTTATT
CAGACACTTGGTTGCCTGACTCAACAGAGGAGAGCCACGTTCAGTTTGTGAACTCTTGGATGCAGCAACATATTGATGATGCAGCAAACTTGCTGGCCAT
GCCCATCGTGATCGGGGAGTTTGGATTATCACTGAAGGATGGCAAGTTTGAAAACGAGTTCCGCGAAACTTTCATGCAGACAGTGTACAACAATTTCTTG
TGCTCTTGGGAGAGTGGAATGATTGGAGGAGGCTGCCTTCTGTGGCAGCTCTTCCCTGAAGGTGCAGAACACATGGATGATGGTTATGCAGTTATTTTTG
CAAAATCACCATCCACATTCAACCTACTTGCAAATCACTCAAGGAAGCTAGAATGCTGAGATTATGCTGCTTCCCCTTCCCCTGCTACATGGTTTTTCAA
GCTAAGAATTTTACTGTAAAGTTAAATGCCTTATATGTATATCATGTACCCTAATAGTTGGTCTCTGGTTCAAAAGTATGTGGTA
page-top