Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig31608  (registered. 2012)
Contig Information
Length 785 bp
Clones alternative view 55 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 7
Wh_yd Spikelet at late flowering 3
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 1
Wh_VWD Shoot grown with dessication 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XN Leaves, plant was grown at constant 23Ž 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 6
WH_XF Seedling, infected with leaf rust 2
WH_XV Leaves, plant was grown at constant 23Ž 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|16517113|gb|AAL24517.1|AF420472_1|AF420472_1 thioredoxin H [Triticum aestivum]
Score 254
Evalue 6.00E-66
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig31608
TTTTTTTTTTATCAGCTCCTTATGAAATCAACCATTTACCGAATAAAGTCACACTTGATTCACCATCATCCATAAACTCACAAGAAGCAAGCAGTACACA
GCATATCCGGTGCCATTGGAGGCACTACTTCTCAAGCGGCAATTTTATTTAGGCGAATACTACTCCGCTAGGTGATTACTAGGCAGCCGCGTGGAGCCCA
ACCTTGGTCGTCAGCTCCTCCTTGATAGCTCCGACAACCCTGTCCTTGACGTCTCCTTCCTTCATGAACAGGAAGGTTGGCATGGCCTCGACGCTGAATT
GCTCAGCAATGGGCTTCAGTTCATCAACGTCGACCTTGAGGAAAACAGCAGCTGGGAACTTCTTGGCGAGATCAGCAAAAATTGGAGCCATGATGCGGCA
TGGTCCGCACCATGATGCAGTGAAGTCAATCACCACCAGCTTCTTGGCGGCGTTGGCCTCCTCGATCTGCATGGTCCACTGCTCCAGGCTGTGGACGGAG
ATCACCTCCCCCGGCCCCACCGCCGCCGCCGTCGCCGCCGCTGTAGTCGTCGCCGTCGCCGCCGCCGCCATCTCTCTCTCTCTCTGCTTGGCAAGCACCG
CTTATTTCTCACGCGCACTTTGTTGTTGCACGGATTCGTCTGCAAAGGATTCAGCCCACCGCCCGTTGGGAAGGGAGCTTCGAGGCGGCCGGCCGCGGCA
CTTCGGCCGGACCGGCTTAGCCAATGGCACGGGCCCTTGGGGGCGCAAGCGCCCCTAACGTGGGTCGGGGCGGGCGGCGGGCGCA
page-top