Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3160  (registered. 2012)
Contig Information
Length 919 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 3
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|9798605|dbj|BAB11740.1|| TaWIN2 [Triticum aestivum]
Score 411
Evalue 5.00E-113
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3160
TTTTTTTTTTGTTAAACACCGATCATGCATAGCTGTTTGATTATAGGAAGCAAGAGTTGAACCCTCTGGTTCAAATCTTAAGGAACCCGTGCATACACGA
GCAGGATTCAAGTTGTAAAGTAAAATAATGCACGAGGACGGCGATGTATAACAATATAACGAAAGAAAGGGTAGGTAAAAGACCCAGCAACAAAGGACAC
ACGAAAATGGTCCTTGTACAAGCATCATAACTACCCGAAGGCTAAGAGAGAAAGAGGGCAGTAGCTAGGACCCTTCACTACTGCTCATCCTCAGGCTTGC
TTGAATCCCTCATTTCATCGCCAGCGTCATCCTGCATATCAGAGGTCCACAAGGTGAGATTGTCACGGAGAAGTTGCATGATCAGGGTGCTGTCCTTGTA
GGAATCTTCTCCGAGGGAATCCAGCTCAGCGATGGCTTCATCGAAGGCCTGTTTCGCGAGCGAGCACGCACGATCAGGCGAGTTGAGGATCTCATAGTAG
AACACGGAGAAGTTGAGCGCGAGGCCCAGCCTGATGGGGTGAGTCGGTGGCAGCTCCTTCATGGCTATGTCCTGAGCGGCCTGGTAGGCACCGAGGGTGG
AGTCAGCGGCATCCTTGCGCTCGGCGGCCGACTTGAACTCCGCGAGGTAGCGATGGTAGTCTCCCTTCATCTTCAGGTAGAATACCTTGGCGTCGATGGC
GGCGGCGGCGGGGACTAGGCGTTCGTCGAGGAGACGGAGGATCCCCGCGCAGATGTTGGAGAGCTCGGCCTCGACAAGTGCGCGGTACCCGCGCGCCGCG
GCGGCGTGCCCCGCCGCTCCGCGCCCTTCCTCCTTCTGCTCGATGGAGGACACGATGCGCCAGGAAGCACGACGCGCCCCGATGACGTTCTTGTACGCGA
CTGAGAGCAGGTCCTCTCC
page-top