Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig31595  (registered. 2012)
Contig Information
Length 1066 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242090647|ref|XP_002441156.1|| hypothetical protein SORBIDRAFT_09g021360 [Sorghum bicolor]
Score 605
Evalue 3.00E-171
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig31595
ACAGACAGCTCCAATGGCGTTCTCCTCCCTCGCCACCCCTTCCTCCTCCTCCCCCTCCTCGTCTTTCACCCTCCCCACCAAGCCCTCCCCGGGCGCAGGC
TCCCTCTCCTTCTCCAGGGCGTCCACGGGGAAGTTCAGGATGGCGGCGGTGAGGGCGGAGGCGGTGGACACGTCCATCAGCCCGCGGGTGAGCGCGCTGC
GGCCGTCCAAGACCATGGCCATCACCGACATGGCCAGCGCGCTGCGGCAGGCCGGGGTGCCCGTCATCGGACTCGCCGCTGGGGAGCCCGACTTCGACAC
GCCGGCGGTGATCGCCGAGGCTGGGATAAATGCAATCAGGGATGGGTCTACTAGGTACACACCTAATGCAGGGACTATGGAGCTGAGGAAAGCTATCTGC
AACAAGCTTCAGGAGGAGAATGGTCTAACCTACAGCCCAGATCAGGTGCTAGTGAGCAATGGAGCTAAACAGTGCATTACACAAGCTGTTCTTGCTGTTT
GCTCACCTGGTGATGAGGTTTTGATACCAGCACCATTTTGGGTCAGCTATCCTGAAATGGCTAGGTTGGCTGGTGCAACACCAGTGATCCTCCCGACAAG
CATATCAGACAATTTCCTGCTAAAGCCAGAGTCACTTGCCTCAGTGATCACTGAAAAATCAAGGCTCTTGATTCTATGCTCTCCATCTAATCCAACAGGC
TCTGTGTATCCCAGGGAGCTGCTTGAGGAGATTGCTGCTATAGTCAAGAAGTATCCTAGGCTCCTGGTTCTATCTGATGAGATCTATGAGCATATTATCT
ATCATCCTGCTAAACACACAAGCTTTGCTGCATTACCTGGAATGTATGACAGAACATTAACTGTAAATGGGTTTTCTAAGGCTTTTGCTATGACTGGCTG
GCGACTTGGATACTTAGCTGCCCCTAAACATTTTGTCTCAGCTTGTGGAAAGATCCAAAGCCAGTACACATCTGGTGCCAGTAGTATATCACAGAAGGCA
GGGCTTGCAGCCTTGAACCTTGGTTATGCCGGCGGTGAAGCAGTTGCAACCATGGTCAAAGCATTC
page-top