Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3159  (registered. 2012)
Contig Information
Length 505 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
WH_XA Root 4
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218194578|gb|EEC77005.1|| hypothetical protein OsI_15333 [Oryza sativa Indica Group]
Score 179
Evalue 1.00E-43
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3159
CAATCAGTTGTACAAATTCAACACTCGAGTACAGTCATGGTACTGAAATCAAGATAATGTAACATCCCATGTTAACTTTTCTCTTATTTGTGAAGATTTA
ACGCAAGAAAACTTGGCTAGCCTGACAGTTTTTAGCTTTAAGCAACTCCTGCCTTGGCTAGCTCCTCCAACTTCTTGTCGATCTGGGCTTCTGTCAAGCC
ATCCAAGCGCACGCACCTCTCCACACCCATATCGTAGCGCGCCCAGAGCTGAGGCTGGACGCCGGAGCACTCGCGGATGAGGACGGGGAGGGTGGGGTTG
CGGGTCTTGATGTCACCGTAGTTCTTCTTCACGAACTCCCGGGCGGGGCCGCTGGCAGGGGAAGACTGGCAGAAGAGGAAGCGGATCTCCTTCACGTTCC
GGGATAGGCTCGCCCGCCACGCCATCGCCGCCGGCTCCTTCCTTGGATTCTCTTCTCTTCTCGGACCCCTTCTATTCTCTGCCTGGGTTGTATCTTCCTC
TGCTG
page-top