Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig31586  (registered. 2012)
Contig Information
Length 1309 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_SHC Shoot grown with cold treatment 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242039493|ref|XP_002467141.1|| hypothetical protein SORBIDRAFT_01g020290 [Sorghum bicolor]
Score 561
Evalue 5.00E-158
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig31586
AAAAAAGTTGCGTTCGCTCGATCGAGCAGCAGGGAAACAAGCCATGGAGAGCTCGCCGCCCACCATCACCGTCCAGGTGAAGTTCGCCGGCCGAACCATT
CCGGTGGAACTCCCGACATCCGCCTCCACCGCGGAGCTGAAGCTCCTCCTCCAGCCGCTAACCAACGTTCTTCCCCGCGGCCAGAAACTCATCTGCAAAG
GAAAAGTTCTTGCCGACGCCGCGAGTCTGAGCTCGATGCAGGTTGGGGACAGATCCAAGGTCATGCTCATCGCTTCGCAGGGTCTTCATCAGGGGGAAGG
CCCCATCACTAAGAATAGCAGTGGTCTTGCAGCAAGTGCAAAAAGAACCTCAAATGTTAAGGATAATCAAACACTAAAACCGGAGATTATCAGCAAAAGC
CGAGCGGAGCGTTGGAAAATAACAGGTGTCATTGCTTTATCTGGTTCCAGCTTGAAGGCAGTGCCTGAGGAAGTCTGGGACTGTGGCTCCTCCATACGAG
TACTAGATGTCTGTAACAACTCAATTGAAGCAATTCCACAGAAAATTGCTGCCCTTAAATCATTAAATAAATTGTTGCTAACCGCCAATGACATATCTGA
TGGGGGCATCAGCTGGGAAGGTCTATCATGTGTTGATACATTAACAGTTTTATCTTTAAGCCAAAATCGATTGGTCACTTTACCTCCGAGTTTGGGCACA
TTGACTTTTCTACGTGAACTTCGCATTGCAAATAACATGCTTGGCAGCCTACCTGTTGAAATAGGTTTGCTGAAGCAGCTAGAGATTCTTATAGCAAATA
ACAATAGGATAACTTCGCTGCCTTCCTCTATAGGCGACTGTGAATCTCTCTTTGAGGTGGACTTATCATCAAATCTTTTAGCCGAACTACCAAAGGCTTG
CGGAAACCTTCACAATCTGAAGACTCTGCATCTAAGGAACAATGGTCTTAATTCCCTACCGCCGACTTTATTCAAGAAGTGCTGGCGGCTTACTACACTT
GATCTCCATGGCACTGGAATCACAAATGACATTCTTCGACAGATGGAGGGCTGGGAGGAGTTTGATGAACGTAGGCGGCAGAAGTATCAAAAGCAGCTGG
ATTTTCGTGTAGGATCATCAGGTGTTTTCGACGAGGGTGCGGATGATGATAACCGGCATGCATAAGTGTCTTTCTTATTACAGACAGGGTTTTGCGCTTC
CAATATTGACCCAGAATTATTCTATAATTGAACTTGAACAGACATGGAGCTGATATTATTCCTCACATTTGGGTTGTGTATTTGTTTATTCCTCTCATTT
CATTACATT
page-top