Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3158  (registered. 2012)
Contig Information
Length 1624 bp
Clones alternative view 50 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 4
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_r Root 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 6
Wh_SHC Shoot grown with cold treatment 3
Wh_VWD Shoot grown with dessication 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_SP 2
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 6
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115485233|ref|NP_001067760.1|| Os11g0414000 [Oryza sativa (japonica cultivar-group)]
Score 775
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3158
GTCCCTGACAGATAACGTAGTCCAGGGTTAAAAATGTGCACTCTGCATAAATATCCATGTAACAACTAATACACGGCACAAAGTAGGTAACGTTCCTTCC
AAATCCTGGTACAAGAATGTCGAAAATGATAGCAGATGACAGCAATGCTCACATCTGAATATAAAATGTTTGTTCAGTAATAAGCAGCAAAAGGATGACC
ACCGTCTCCGCAAACATGGGGTATAAGGAAATACTCATTTTAAAGCAACAACCGTGCCTCTTTATTCTTCCTCCTCGGCCTCCTCGAGCCATTTGACGAA
AGGCTCCAGAGCTTTCACGAAAGATTGCCTTCCTTTTTGGTTTGAACCCTTGCGGAACCAAAGAAGTATGGTATCTTCAGCTAGGACATCTTGATCATAC
AGTGATCTTATAATTTCAGGGAACAGCTTCATCAACTTAGCATCCTCATAACACTGTGTCTGGACCTTGTATATGAGTTCCAGTTCTAGCTTTCCACTTG
TGCAAAATGCATTCATAAGACCAGCCCAAGCATTCACCTGCCTAAGTGCTGAATTAGAATTTTGCTGCTGGTTCTTTCCAGACCACTGAACAGCCTCCAT
CAGCACATCCCACAGCATGCGAACAACCTCTATATCAGGAAATTTAGCATCTTTAACCTGTTGCTTGACAACCTCAGTTACTTCAGATATTTCAGCTTCT
TCATTGATCATAGTGGTCAGAGTTGACTTTATCTCCTTGAGCTTAACTTCAAACATTTTCTTGCTATTGTACTCAACAAGGCTAGTCAAACCTTCTTTGG
TGAAATGCTCAGACAAAGCCTCAGAGGTTCTCTTTCCTGATGGAAAAAATTCAAGTAAATTGTCCTCCATTTTGCCTTTCTTTAAAAGTGCAATCAGATC
ATCCAAACTATTTTCCTTCAGATATTCCTTGAAGAACTCAGTAATGAATGAAAGCACTATCCCTTTGGCAACAAGATTGTCCTTAAGCAATGGCTGAAAG
ACAGTTTCAGGTGGCAGACCTGATAATTTCTGAGAAAATGCAAGTGCCGTGAAAATGGCAAGTTTCTGTCTCTCATTTTCTTCAAAGAACTCCAAAGACT
GGAGAAATTTTCGCATAACATTTTCAAGACTCTTTATTAAGAAAGGCCTCCTGCGCAATGTTTTCTGAATAAAGAGGACATAAGGTAATATTGCTTCACG
TTGTGCTGCACAGTCAATGAGAGAATAGGGGTGGCGCTCTCCCTCTTCTTCGGGTTTAATCGTACCAGGCTGAGTACGCACACCAATGAAAACAACCTCA
AAGAAAGTGTCACCGTAACGTGAGAAGTTGAGATCTGATGACTCTATACTTTTGGCAACAAGTTCCAGGTCTCCAGCATTATCCAGATAAATCTGGACAA
TTGCATCAGAGAACGACGAAGGGTCCAAAGGAGCTGCGATATTCCGCTTGCGGGTCTTAATCCGCTGGCCTCCGAGGGTGGGCTTCTCCTTCGAGCTCAT
AAACAACGATCTGGCACGGAGAGGAGAGGTGAAGGAGATCGGGGCTTCGAGGAGGTCGGTTGTGCGGCCGCCGAGGCGATGATGGGTGGAGTGATAAAAA
CCTAGCTTTCGGGGATGTGCTGCG
page-top