Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3157  (registered. 2012)
Contig Information
Length 850 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_SP 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222613028|gb|EEE51160.1|| hypothetical protein OsJ_31927 [Oryza sativa Japonica Group]
Score 305
Evalue 3.00E-81
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3157
TTTTTTTTTTACCTCTAGTGATCAAATCACAGATCCATGGACAAAACAATATCAGTTATGATGGGGTACATAGGGCTGGGAATGGAACATTTAAAGACAC
GATTTGAGAATGAGGGCAACCAAAAGAGGCATGTAATTTGATGCAAAATTCCACCAACATATCAGACGAAACTCGCGTACATGACAAAACCGGTCCACTG
GCACAAATAAGGTAGGTCAGAGTTCTTGAAAGGGGAGGTCTCTAATGGCGCCGCTTAACTTATAACCCTTCACAACAGTAAACACGCATCAAAATCACGA
CTCTGCCTTTTTCTCTTCAGCGGCCTCTTCAAATGTCTCTCCAGGGACAAGCTCAGGAACATCATCATCGTCGTCAGCCTGAGCAGCACCTGCACTGGCA
CCAGCCTCGATGCCAGCAGCACCACCAGGGACCTGCTTTTGGAATTGCTCTGCAAGCCTCCGCAGGTTGTCCAAGTTGTCAGGACCAAGTTGATTGATAA
TTGATGGCAGCAGATCTTGCAGTTTCTTTGTCTGTGGAGTTCCACTGACTACCCATGTATTAGCACCAATTGAAGCTTGCACTTTAGGATTCAGAAACTG
AATAACCACATCATCCTTAAAGATGTTGACCTCTTCGATACCAGGAATGGTGTTCACTCCTACTCTTTTCAGGGTACTCTGGAGCCTTTTGTCATCTGTA
GTTGTGGTCTTGTGTACAGCCTTCTTCTTCCTGCGCATGCTACCCTTCCCCCCGGTGCGCACGGCACCTGCCATCTTCTTGAGCTTTTCAACATTCATCT
TGGCTGGGGGAGGAGCGGAAGCCGCGGCGAGGGCGCCGGCGGCGGCGCGA
page-top