Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3148  (registered. 2012)
Contig Information
Length 975 bp
Clones alternative view 149 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 5
Wh_dL Crown of seedling 9
Wh_e Seed DPA10 7
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 4
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 5
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 6
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 3
Wh_VHS Shoot with heat shock treatment 3
Wh_VSCB Liquid cultured tissue 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_XT Roots, 18 day old plants were grown hydroponically 6
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 2
WH_XA Root 12
WH_XB Root 9
WH_XC Root, treated at 50 microM Al for 6h 15
WH_XD Root, treated at 50 microM Al for 6h 12
WH_XE Seedling, infected with leaf rust 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|109940155|sp|P31674.2|RS15_ORYSJ|RS15_ORYSJ RecName: Full=40S ribosomal protein S15
Score 300
Evalue 1.00E-79
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3148
AAGTCTGTCCAAATAAACCAGCTGCGGCACCACAGGATAGTTTTAATGTGACAGAATTTTTGTAATCTCCTCGTGCCGAAGGCCGCAGCTTCCCATTCCT
CGCCGCCGCCGCCGCTTCGTACCCGCTCGAAGCCGACCCGACCATGGCGGACGTCGACGTTGACACGGAGGTGGCCGCCGGCGCGCAGCCGAAGAAGAGG
ACGTTCCGCAAGTTCAGCTATCGCGGCGTGGATCTCGATGCCCTCCTCGACATGTCCACCGACGACCTTGTCCAGATGTTCCCCGCTCGCGCCCGCAGAA
GGTTCAAGAGGGGTCTCAAGAGGAAGCCCATGGCGCTCGTCAAGAAGCTGCGCAAGGCGAAAAAGGACGCTCCTGCTGGTGAGAAGCCTGAGCCAGTGAG
GACACATCTTCGTAACATGATCATTGTCCCTGAGATGATTGGCAGCCTTATCGGTGTCTACAATGGCAAGACCTTCAACCAGGTTGAGATTAAGCCTGAG
ATGATTGGCCATTACCTTGCAGAGTTCTCTATCTCCTACAAGCCAGTGAAGCATGGTAGGCCCGGTATTGGTGCCACACACTCTTCCCGGTTCATTCCTC
TTAAATGAGTTATGCCGCTTTCTACTTTGAAAGAATTCAGTACGGACCATCTGGTGGCATGTCCATCTAGCTGTCTCCCTTGTTTTGAACCAGTTATATA
TCTAGTATTTGGTTCTGTTTAGCTATAATTTCGTTATGCACAATGAGCTGTTCTACCTAAATGCTCTGAGAATCTTGTTTCCATTGTGAAGGTTCATTTT
GATTCATGCTGTGCTTGTCAGTTTGTGAGATTTTTACTATGAAATGCACACTTTTTGATTGGCAATCATTTGGCCTGCCCATCACTACTCAAAATGGCCA
TCTGATGGCCACAACACGAGCTCATAAGCTTTGTGATAACATCGTTTTGATTCTCAGCCCATGTAGCCTTGGGTT
page-top