Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig31471  (registered. 2012)
Contig Information
Length 1521 bp
Clones alternative view 32 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 9
Wh_VSCB Liquid cultured tissue 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 6
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|238008730|gb|ACR35400.1|| unknown [Zea mays]
Score 632
Evalue 3.00E-179
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig31471
ATAATGGAAGCGACAGCAGCAAGCATACAAGTAGCATAAACCATGCTGGTGCTGGCACTGCCCTGCCATCAAAATCTTGCATCCCAAACCATGGAGCGAG
AGCCCGGGACACACCGCAGATTCGTGGTCCACCCCACCACAAGCTCGATGCCCGCAAACAATGGCAGCATATCACCAACCAACAGGCAGACACGGTGGGG
AAACGGTCCAGGCACAACGCTCCAGGAATCACAAAAGGATGCCGCATCCATCACCAGGAACACACAGGAACGATACACATACACGGCAACAGCAACAGGC
CCACTCGACAAAATGTCTCACACGCTGGACACACCGACTACACAGGACATTCGGTATATAGTTTTTTCACAGAATCGGGTACTGGAGGTAAGCACCTCCG
GCTAGGGAGAAAAACCCCACCAGGCGGCACGCTGCACAGCTGACGAAGCCGACCGACCGCTTCATCTGTACGACTCGAGGCGCTTCGGCTTGCTCTGGAC
GACCGCCTCGATCTTCTCCAGGACCTCCGGGGTCAGCAGCGGGATGACTTCCAGGGCCTTCATGTTCTCCACGATCTGGCTCTCTTTGGTGGCTCCAGTG
ATCACGGACGACACGTTGGGGTTCGACGCGCACCACGCGATGCCCAGCTGGGCCATCGAGACGCCGAGCTCCGAAGCGATGGGCTTGAGCCCGTTCACTT
TTCTAAGCGTGTCGTCAACCAGAGACCTGTTGGCCAGGTTCTTGTAATTATCTAGGGCAAACCGACTTTCAGCAGGTATATTCCCTTTGCTATACTTCCC
AGTGAGAACCCCTGAAGCTAGGGGACTCCATGTAGTCAACCCAATGCCATAAGTACTGTAGAGAGGTACAAACTCAGACTCAACCTTGTGGCGGGAGAAG
AGGTTGTACTCGGGCTGCTCGACGATGGGCCCGACGAGGTCAAGCCGGTTCGCCACCCCCCACGCCTCCGTGATCTGCTGCGCGGTCCACTCGCTCGTGC
CCCAGTAGAACGCCCACCCCTGATCGATCACCCAGTTCATGGCCCGCACCGTCTCCTCGATCGGCGTCGTCGCGTCGGGCCGGTGGCAGTAGACCACGTC
GACGTACTCCATGTCGAGCCGCTTGAGCGAGGCCTTGAGGCCCTCGACGATGTGCTTGCGGGAGAGGCCCTTGTCGTTGGGCCCCTGGCCGCCCCAGAAG
AGCTTGGTGGAGATGACGACGTCGGCGCGGCGCCAGCCCAGGTCCCGGATCGCCTGCCCCATGATCTCCTCCGCGCGGCCGTTGGCGTAGACCTCGGCGT
TGTCGAAGAAGTTGACCCCCGCGTCCCGGCAGGCCTGGAGGAGGGATTTCGCCTCCTTGACGTCGAGTTGGTTGCCGAAGGTCACCCACGCGCCGTAGGA
GAGCTGGCTGACGCGGAGGCCCGACCGGCCCAGGTTGTTGTACTGCATCTTCGATGGCTGGGTGGCTCGCCGCCGCTCGCCGCCGGTGGGGATGGGGGTG
GGTTTAGATCTGTGTGGGGTG
page-top