Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig31457  (registered. 2012)
Contig Information
Length 696 bp
Clones alternative view 33 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 1
Wh_yd Spikelet at late flowering 2
Wh_SH - 1
Wh_DPA20 Seed DPA20 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_SHC Shoot grown with cold treatment 4
WH_XN Leaves, plant was grown at constant 23℃ 7
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig31457
TTTTTTTTTTTTTTCTTTCCAAATGATCCATTCCATTACCATATAGTATTTTATAATTTAAGGAAACTGAGTACAAGCATCCAGCAAATCTTACGAATAC
CAAGTACATGCCACCCTTATCGCTAGCCCGAAAGCTTACACTCGAATCTGGTGGGCATGTCAAGATCAAAGGATGATTCAACCTTGTGAAGCAAGAAAAT
AGCAAAACATCACATCCGTCCAGCAGTTTTGAAGATCGAGACACAGAGCGACAACATAGGAAAGATTCAAATACTACAATACTGCAAAGCTAGTTCATAT
TAGAGCAAGAGACGATATTGCTTCCTAGTAGCGCATCTTCATTCTTCTTCCTGAATCTCAGCCAAGGTCTTGAGTGTCATGCGCACTTCACGAAGGGTTA
CATCTTTATGACCATCGACTGGACTCTCCCTGAGAATCTTGAAGACATTCAGAGCCGTAGCATCAACATCCTTGACACGAAGTTTGGGGAATTTCCTGGC
AGCCTTGAGATGCCCAGGATCAATGTCGGGGAATTCCTTGGCAGCCTTGAGCTCGTAAATGCCCGCTGATCTCCCGAGCGCACGGTCGCAAAATCTCCTC
ACCGCTAGCCGGAGCGCCGCCATCGTCCTCGCCCTCGCTCTCGCCGACTCGATCCGCTTCCTCTTCCTCTTCCTCGCTGGTTGGGGAGAAAAAAAA
page-top