Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3136  (registered. 2012)
Contig Information
Length 1055 bp
Clones alternative view 51 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_SH - 2
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 4
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_XB Root 2
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XV Leaves, plant was grown at constant 23Ž 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|15240250|ref|NP_200949.1|| RPE; catalytic/ ribulose-phosphate 3-epimerase [Arabidopsis thaliana]
Score 388
Evalue 5.00E-106
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3136
TTTTTTTTTTGATGTGAGCATTATTATTTGAACACGGATCAAATGGATGCCTGCTTTGCTTTGTATCAGCAAGGTTTTCTTCAGTCAATTACCATGGACC
ACTAGACTGATGGTACAAAGATGAAAGATGAGAGGAGGAGTTGCTTAATTATGAACAATCCTGAGCTCGCGGTAATGTTATCACACAGGACACGTCGTTC
GTTGCCCTTGTTATGGAGTGGACATAGTACAAGATATACACATCCTCGCAGTCGCAGACAACTGGAAAAAGAAACTATCTTTCTGTGCTGCCTCTTTTTC
CCTATCTGATGATGGTGATCTCTGTGATACAACGTATGGCTTGACAGTGAAAGGCACCTATGCATTGCAAACCACGATAATGGTAAAAAAAATGTTACAC
AGCGTAACATGCTCATACTCCGGTTCTTCATGCTGCTACGGCTACAGGTCTTTTGCTGGTCTTGATTCCTTTGATAGCTTCAGCGTAGTCTTTAGCTCCG
AAGACCGCAGAACCAGCAACAAGGGCATTCGCTCCAGCTTCAATGACCTTGTAGGCGTTTTTGGGACTGACTCCGCCATCAACCTCGATCCAGGGGTTCA
CTCCCTTCTCTTCGCATAATTTTCTCAAATCGGCGATTTTCTTTACTTGACTCTCAATAAAACTCTGCCCACCAAAACCAGGATTGACTGACATAATCAA
TACCAGATCAACAGATTCAAGTACATATTCTATCGCACTGAGTGGGGTCCCGGGGTTCAAGACAACTCCAGCCTTTGCTCCTAGACTTTTAATCTGGTCG
ACTGTTCGGTGCAGATGGATGGTTGCTGTTTGCTCACAGTGGACGCTAACAATATCAGCACCTGCCTTGATAAAATCTGGAATTCGCTGCTCAGGTTCCA
CAATCATCAGATGCACATCCAATGGAAGATCAGTCACTGGACGCAGAGCATCAACAATCAATGGTCCAATCGTGATGTTTGGCACAAAGCGACCGTCCAT
GACATCAACATGAATCCAGTCACATCCTGCCACCTCCACAGCTTTTACCTGTTCA
page-top