Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig31333  (registered. 2012)
Contig Information
Length 2024 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_SHC Shoot grown with cold treatment 5
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|108708130|gb|ABF95925.1|| Nucleolar protein NOP5, putative, expressed [Oryza sativa (japonica"
Score 898
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig31333
CAACCAGTTCAATGCCGCTCAGGTCGCCCTGAACGCCGCTTTTCTGCCGTCGATTATGCTTTCCGGCTTTATTTTTCAGATCGACAGTATGCCCGCGGTG
ATCCGCGCGGTGACGTACATTATTCCCGCTCGTTATTTCGTCAGCACCGGTTCGCCCTCTTCAAGGTGCTGGACGAGGGGAAGCTCAGCAGCGTCGAGGA
TCTGTGGAAGGACTTTGCTTCCTCGGACAAAGCAAGAAAGGTGGTTGAGCTCAAGGCTTTCAACAAGTTTGAAAATACCTCGGATGCTCTTTCAGCGGCT
ACTTTGCTAATTGATAGCAAGCCCAGCAAGGGTCTGCGCAAGTTCCTGCAGAAGCACTGTGATGGTGAAACATTGGCTGTTGCTGATTCTAAACTTGGGA
ATGCCATCAAAGAAAAGCTGCAAATTGATTGCCTTCACAACTCTGCTGTTATGGAACTGATGAGAGGGCTGAGGAACCAGCTCACTGAACTTATGTCTGG
ACTAGCTGAGCATGATCTAGGTCCAATGAGCCTAGGATTGTCCCACAGCTTGTCTAGGTATAAACTCAAGTTCAGCCCTGAAAAGGTTGATACTATGATC
ATTCAGGCCATTGGCTTGTTGGATGATCTTGACAAGGAGCTTAACACTTATGCTATGAGGGTCCGTGAATGGTACGGTTGGCACTTTCCGGAGCTCACAA
AAATTGTTGCAGATAATATCCATTACGCGAAAGCTGTGAAGATGATGGGCAATCGTGTTAATGCAGTTAACCTTGACTTCTCTGAGATACTGCCAGAAGA
TGTGGAAGCAGAGCTGAAGGAAGCAGCTGTCATTTCCATGGGAACAGAAGTTAATGATCTTGACCTCTCAAACATTAGGGAACTGTGTGATCAAGTCCTG
GCTCTTTCTGAGTACAGAGGCCAGCTCTATGACTATCTAAAAAGTAGGATGAACACCATTGCTCCCAACTTGACTGCACTTGTTGGTGAACTTGTTGGCG
CTCGCCTTATTTCCCATGGTGGTAGTTTGATGAATCTGGCGAAGCAGCCTGGCAGCACTATTCAGATTCTGGGGGCAGAGAAGGCCTTATTCAGAGCTCT
GAAGACAAAGCATGCTACACCAAAGTATGGTCTCATCTATCATGCATCATTAATTGGACAGGCGGCTCCGAAGCACAAGGGAAAGATCTCTCGTTCGCTT
GCTGCTAAGAGTGCACTTGCCATAAGATATGATGCCCTTGCTGACGGTGACGATAACTCCATGGGTCTTGAAAGCAGGATCAAGCTTGAAACACGGCTCC
GAGTTCTCGAGGGTAAAGAACTTGGGAGGTCTGCTGGTTCCACGAAAGGAAAGCCCAAGATAGAAGCGTATGAAAAGGACCGGAAGGGTGGTGGTGCTCT
GATCACTCCCGCTAAAACTTACAACTCAGCAGCAGATCTTGTGCTTGGACAAACCACTGAAGAAACGCCAAAGAAGTCAGAAGTTGCTTCAAAGAAGAGG
AAGCACCAAGAGGAAGAACCTACTGCGGAGGCAGCTGAAGAGGACGGCGAGCAGGAGAAAGAGAAGTCCAAGAAGAAGAAGAAGAAATCCAAGGACATGG
AGGAGATTCCAGCAGCTGTCACCGACGCTAGTGAGAACAAGAAAAAGAAGAAGAGCAAGGAGACCGAGGAGACCCCTGCAGCCAACACCGACGGCGAGAA
GAAAAAAAAGAAGAAGAAATCAGACGCCGAGGACGCCCCCATGGAGATCGACGTGTCCGCTAAGAAGGACAAGAAGAAGAAGAAGAAGCACGCTGATGAG
TGAGCGCCACGGAGATATGGCGGAAATTTGTGGTGTAATGCTGTAGTATCATCATATGAAAGTTTTGGTACTTGCCGTTCATGTAGAATGGAATGCCACA
TTAGGATTAGCAGCGACGAACCCTACAATTCGAAACTTGCAAGTGGTGAGCAGTCACTTTAAGAGGCCCAATGCTGTGCTCTCATCTATAACATCTGCTA
GTATGTTCATTCTGTCGAGTAGTA
page-top