Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig31320  (registered. 2012)
Contig Information
Length 1189 bp
Clones alternative view 82 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_oh Pistil at heading date 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 8
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_SP 2
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XE Seedling, infected with leaf rust 5
WH_XF Seedling, infected with leaf rust 10
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115437604|ref|NP_001043336.1|| Os01g0558600 [Oryza sativa (japonica cultivar-group)]
Score 394
Evalue 9.00E-108
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig31320
TTCCTCTCCCTCGGTCGTCGCCTTCGCCTCCCGGGAAATCGCCTGCCGCCTCGTCTCCTAGAAACTCTCCGCCGCCGTCCGCTGCCATGAATCCTGAATA
TGACTACCTCTTCAAGCTGCTGCTCATTGGGGACTCGGGCGTGGGGAAGTCCTGCCTGCTGCTGAGGTTTGCGGATGATTCATATCTGGAGAGCTATATC
AGTACTATTGGTGTTGACTTCAAAATCCGCACCGTTGAGCAAGATGGGAAGACGATAAAGCTGCAAATTTGGGATACTGCTGGCCAAGAGCGATTTAGGA
CCATCACAAGCAGCTACTACCGCGGTGCCCATGGCATCATTGTTGTGTATGATGTGACTGACCAGGAGAGCTTCAACAACGTCAAACAGTGGCTTAATGA
AATCGACAGGTACGCTAGTGAAAATGTGAACAAGCTTTTGGTGGGGAACAAGTGCGATCTAGCTGAGAGCAGAGTGGTTTCTTACGAGGCTGGCAAGGCC
CTTGCCGATGAGATTGGAATACCATTCCTGGAAACCAGTGCCAAGGATGCAACAAATGTGGAAAAGGCATTTATGACCATGGCCGCAGAGATAAAGAACA
GGATGGCAAGCCAGCCGGCTGGAAATGCCAGCAAGCCTGCCACCGTGCAAATGCGGGGTCAGCCTGTTGCTCAGCAGAACGGATGCTGCTCGTCTTGATC
AACACTCAAAGATCACAGTAGTGTTCTTGCAAAACTCAATTGGTTGTTCTTCCCCTGTAAATTAAGTGTACTACTATCATGCCGTCTGTTGGAAGAAGTG
TCATGTCCCCTAACTACAACAGTGCAGCAGATGCTGTGGCCTGTTTTAGCTGACTGTTAATATTGCTATTTTAATGTGTGTCGTTTACTATTCACCCTCG
TTTGGTTAATGTTTCATGTCTCCATGCTTTGAAGTTCAATGCTGGTGACTGTATTGCGACGATGAGCGATCATAAATTCACCTGGCATTATATTCTCAGG
GAAGACATATTTGCTTCTATCCGTGGAATGCTGCTTTTTGAAGACCACTTACGTTGCAGCTGTTATGTTTGGTACCTGCTTGTCAGATGATTGTTAAACA
GCAAATACTCTATCTCCCTTCTGTAAACACCGTTATATAATGTACATTTTGATAAAATTCACTGCCTAGCTCCGATGATCGATGGCTGC
page-top