Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3128  (registered. 2012)
Contig Information
Length 1189 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_VSCB Liquid cultured tissue 1
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218195198|gb|EEC77625.1|| hypothetical protein OsI_16613 [Oryza sativa Indica Group]
Score 380
Evalue 1.00E-103
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3128
TTCGTACATGGATACAGAAAATGGTGAACACGGGAAATATTGATTATTAAGTATGATCCATCGGAACAAAATGCACCGCGGGGCATTGGGAGAACACCGA
TGGCAACCCTCCGATACGATATGTACCACTACCAACAGAAAAATGCATCCAAAGATGCAGCTGAGTAAGTTGTGCTAAAAGGAAAAGCACGAAAACTAAA
ACTGCATTGCCTAACTAGTGATCCCACACTTGCAAACAGGGCACAGTTTCTTTCTTCTCAGCCATTCGTCGATGCACTCTTTGTGGAACTTGTGAAAGCA
TGGCAAAGTGCGGATGGTATCTCCGAAAGATGGATTTTCAAGGCAGACTGCGCAAGGCTCTTCGGTGCTAGTTGACTGAAATACTGACTGAGGCAAGTTA
TTGATCTGACTTTCCGACGCACCAGTATGCTGGTGGTTATTTTCATCTAACGCAAGTAGCGCATCATAATCATTTAAATCGATATTAGGTTGAATATGCG
CAGCACGATATCCGGCACGAAAAGCCCTCAAACCCAAAGTTACTGGAGCTGCATTGTGCATATGGGAAATTGCCGTCTCATATCTGGCCCTAATACCACG
CTGAGAAGCACTTAAACGCGATGCCCGTGCAGCTCTAGTATCGTTGGGATGCCACCTTGCAGGTGCTCTTACAGCTCGAGATGTCCGTTCTGCATCTTCT
TCATGTTGAAGTGACATTGCTACGATTGCATCAATCTCTTCTCTAGGAGCAACACGAGGTGTTTCATTGTAAAGCTGCTCCTGAAGTTGCCGAGCCAACA
ATTCATCAGCCTCCAACTGTGCACTTACGTTAGGATCAATCGAGGTTCTATTACTGCGGCCACTCAAACTAGATCGAGCTTCAGGGGAAGATATGTCATC
AATATCTATTACAGAAATATTATGACGACGAGTGGTACGATTTCTGCCAGCTGTTGCGTCTGAAGATGCAAGACATGAACTACCAAGTTCATTAACAGAA
CTAGAGCTTTCACCAGGATGATAGGAACTTGAGGTGTGTTTCCTCTTTCCTTTACTGATCCTTATTGTCCTATTCCTCAAACTTGCAGACCGCGCAGCGG
TTGCTGCACCAAATGAGTTATTGCTGTCTTCTGTTGCGGTTTCATGACCCTGATCAGATGGTCCAGAAGATCCAGATTCCATTCCAGAA
page-top