Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig31197  (registered. 2012)
Contig Information
Length 1052 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_PCDAM Anther at meiosis 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115464323|ref|NP_001055761.1|| Os05g0461300 [Oryza sativa (japonica cultivar-group)]
Score 407
Evalue 1.00E-111
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig31197
ACACCACAGCATCACAACAAGTTATTCCATGCATATTGATTGCTCGGAAAGAAACAGCAGCAAGCCAACAGCATGGATTTGAAATCATTACACACTGTAG
CGAGAGGTTCAACGGACTGGAATCCAGCGTACAATAGCTCCCAGCAATGGCAACAGCTACGTCAAAGGCAAGGGTAGTTGCTTCAAAGAATGGGAAGCGA
ATATAAGTACAACCAGATCTGTATCATAAGTCATAATTTTCTTCTTGATTGAGATTCTTCCTATAACAGACAAGCAGCAGGAACCGAATGATGTCAAATA
AACAATGATCACGGACACACTGACTCGTCCCTTAAGAGCCACAGCAGGCAGACCCCGAAGCTGCCGGGGCGTCGCCGCCTTCTGCCTTGTTAATCTTGAT
GGTCTTGTCCTCAGGCTTGGAATCGGTCTCAGCAAGCCTCTGCTTAATGTCGCGGGCAATGGAGAAGAAAACTTGCTCCACGTTGAGGTTTGTCTTGGCA
CTAGTTTCAAAGAACTTGATGCCGTATTCATCAGCCAAAGCTTGCCCCTTCGCAGTAGGTACAGCCCTTTTACTCTCATCCATATCAGCCTTGTTGCCAA
TCAAAATTTTGTTGACATTGTCAGAGGCATGCTGCTCGATGTTCCGGATCCAGTTCCTTATGTTGTTGAAAGATGACTCATCGGTGACATCATAAACAAG
CAGGATACCCATGGCTCCACGGTAATACGCAGTGGTAATAGTCCGGAAACGTTCTTGACCAGCCGTGTCCCATATTTGTAGCTTAATACGTTTCTGATCC
AGCTCTATTGTTCTGATCTTAAAGTCAATACCGATCGTGGTAATAAAGCTCGTAGTGAAGGAGCCATCAGAGAACCGCAGGAGGAGGCAACTCTTGCCAA
CACCGCTGTCCCCGATGAGGAGGAGCTTGATGAGGTAGTCGTAGTCGGCCCGGGCCCTCGCCGGCGGCGCAGCCATGTCGCGCGCACCCGCCTCCTCCTC
GTCCTCCTCCTCCTCCTCCTACCCCTCGATCGGCGCTGGTGCTGATCCCCCG
page-top