Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig31132  (registered. 2012)
Contig Information
Length 831 bp
Clones alternative view 183 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 4
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 7
Wh_oh Pistil at heading date 1
Wh_r Root 7
Wh_yd Spikelet at late flowering 4
Wh_DPA20 Seed DPA20 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 7
Wh_PCDAM Anther at meiosis 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 13
WH_XN Leaves, plant was grown at constant 23Ž 22
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 6
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 8
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_CA 2
WH_SP 9
WH_XA Root 11
WH_XB Root 12
WH_XC Root, treated at 50 microM Al for 6h 12
WH_XD Root, treated at 50 microM Al for 6h 9
WH_XE Seedling, infected with leaf rust 10
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 9
WH_XV Leaves, plant was grown at constant 23Ž 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1709779|sp|P52184.1|PROF1_HORVU|PROF1_HORVU RecName: Full=Profilin-1
Score 272
Evalue 4.00E-71
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig31132
TTTTTTTGCAATGACAAAGTACCATGACCAGTTTTTTTTTTCAGTAAAATTGCAATCATCTTCAATAAAGCAGCAGCAGAACCCACAAGTTACCACGACC
AGGCAAATGTACATTACTCAGCGAAAGAGCGGCTGAGTTTGATACGACGCGATGCCAAACATTAAAAAGAAAAACATAGTAAATCCATTTTTTCCCTTCG
ACACATCATCAACCGACAAACCCCAAGCTAAAATTATTCACTGCATATATCATGCGGTACGCCAAGCAGATGGATGCAAAGCCCACAGTAGAGCAAACTT
AGTCCCAGACGACCAAAATAACAGCATATCAGGGCGGGCTTAGAAACCCTGCTCGACCAGGTAGTCGCCAAGCCTCTCCACGACCAAATTGCACTGGCCA
GGAGTCATGGGCTCATCGTAGATACCGAGAATCAGGGCCATGCCCGTCTTCTTGATAGTGATGCCACCGGTGCCCTTCTTTCCTCGGATGACAACCCCAG
GTTCACCTTGGATGACCATGTACTTTGTGCCTCCAAGGAAAAGACCAGTTGGTGCAAGGTGTCCAGGTTCGTCAAAGTCTTTAATGATGCCAGCAATCTC
CTCAGGCTTGAACTGGGGGAAGTTGGGGGACTGCGCCCAGACGCTGCCGTCGTGGCCGAGGATGGCGGCGGAGGTGAGGTGCTGGCCGTCGATCTCGCAG
CACAGGTGGTCGTCGACGTACGTCTGCCACGACATCCTCCTCCTTCTCCGGCGGCGACTTCTCTCGGCGGCTGCTGCGTGGAGCGCACGCGGTCTCGGCT
GGGGATGCTTTGCTTGGACCTGGATGTGTCG
page-top