Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig31127  (registered. 2012)
Contig Information
Length 835 bp
Clones alternative view 147 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 11
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 4
Wh_r Root 1
Wh_yd Spikelet at late flowering 5
Wh_CSEC Callus 13
Wh_EM Dormant seed with water absorption 8
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMV Shoot grown with continuous light after cold treatment 6
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 6
Wh_SHC Shoot grown with cold treatment 5
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 4
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 9
WH_XN Leaves, plant was grown at constant 23Ž 8
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 6
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 11
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218199747|gb|EEC82174.1|| hypothetical protein OsI_26284 [Oryza sativa Indica Group]
Score 234
Evalue 7.00E-60
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig31127
CCGCGGTCGGCCGCCTCGAAGCTCCCTTCCCAACGGGCGGTGGGCTGAATCCTCAAACCCAAAGAGGAGGAAGAACACCAAGGACTCACTACCAGCGCCT
CTCCGCGATCCAAATCCTCCCGGGAAAGATCTTGGTTGATCTCTTCCTCCTCGACCGCCTCCCAGGTTCTTGGTGCAGCTTTTGCCAGTCTCAGCAGGAG
ATTTCATGTCTGATCTTGACGTTCAGATCCCAACTGCCTTTGACCCCTTTGCCGAGGCGAATGCTGGGGACGCTGGTGCAGCTGCCGGATCAAAAGACTA
CGTTCATGTACGCATCCAGCAGCGTAATGGTCGCAAGAGCCTGACCACTGTCCAGGGTCTGAAGAAGGAGTTCAGCTACAGCAAGATCCTCAAAGACCTC
AAGAAAGAGTTTTGCTGCAATGGTACAGTTGTCCAGGACACAGAACTTGGACAGGTCATTCAACTCCAGGGTGATCAGAGGAAGAACGTCTCAAACTTCC
TTGTCCAGGCCGGCATTGTGAAGAAGGAACACATCAAGATTCATGGTTTCTGAGCAACTGCCAGCTCCATATCAGAGTCTACATGCAAAGCAGCTATATA
TTGGTGGTGCAGTATATTTAGTTGTGTGCTAGCGCTAGCAGGCGTTACCAGCTTGCGCGCTCTGAGTATACAGAAAATCTAGCATAGCCCACCTCTCTGC
GTGTATGCTTGTTACCGTTGTGTTGAAACTTTGTAAGGAGCACCATCTTTAGATGGCTTGTTACCCTCTCCCATCAAGGTTGAATAATATATGCTTTGTT
AAGCGTGGTAACCTTCGTATCATCCAAAAAAAAAA
page-top