Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig31126  (registered. 2012)
Contig Information
Length 824 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125545848|gb|EAY91987.1|| hypothetical protein OsI_13677 [Oryza sativa Indica Group]
Score 176
Evalue 2.00E-42
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig31126
TCACCATCATCCTCACCTTATTAAACCAAAAACCCGCGCACCTGATCCTCCAGTGCTGTTCGCCATCACAGCGTCCGTGATAGAGAGTGTGATCCTGCGC
CTGGTAGCCCGGGGAGCAGGCGCAGCGTTCGTTCTTGCAGGGAGAGTGGGTCGAGCGATCGGTCGGGAGGGTGGCATGAGCCCGGGGAGCGGGAAGCTGC
GGTGGCTGTGGAGGGCGCCGGCGCGGGCGTTCGGCCGCGCGCGGGACTTCTACGTGCGGAGCATCACGGGGTGCGCGCGCTACGTCCCGGCCGACGCGGC
CTTCGGCGCCTATCCGGTGCTCGTGCCCGCGCCGCTGTCCAGGAGCCAGAGCTGCGGCTCCGGCGCCGACTATGGCGGCGAGGAGGACCTCCGGGAGCTC
ATCCGAGCGGCCTCGCAGAGGCGCGAAGGCGAGCAGCAGCGGCAGGCCGTCCATCTCCATGCCGTGCCCAGGAGCCAGAGCGTGGCGGGGGCGGCGTCCA
TGGCGCCGATCGACGAGGACGCGCCGTGCGAGTTCGCCGGCGGCGCGGGCGCCACGCTCTACTCCCGCAGCCAGAGCTACGCCGGCGGGGCCATGGGGCC
CAGGAAGTCTCACTGCCACACTAAGATGTCGGCCTTGGGCTGAGCTAGCTGCCGTGCCGGCTGCTCCTGGACTGCTCGTGTGTGATCAGGTCATGCTTGC
CAAAATTTGTTCATGCTGCTCCGATCCATCTAAAATTGGGATCTTGAGCTTGTAAATAGCACGATACAGGGAGGAATTCATGCATGTGTAATTTGCTTGT
TTCGTTTTACTCTCGGTTATGCTT
page-top