Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig31080  (registered. 2012)
Contig Information
Length 2130 bp
Clones alternative view 75 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_SH - 18
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 3
WH_XN Leaves, plant was grown at constant 23 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 7
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XV Leaves, plant was grown at constant 23 8
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 13
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222619334|gb|EEE55466.1|| hypothetical protein OsJ_03634 [Oryza sativa Japonica Group]
Score 607
Evalue 1.00E-171
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig31080
ATATGTTCTGAAGGCATATTTATTGTTCGGAGATGAAGAATACTTGTATGTATTTCAAGAGGCTTACAAGGCTGCCATGCACTACCTCCACCATGATCCT
TGGTATATTGAGGTAAATATGAATTCTGGTGCTACTGTTTGGCCACTATTCAATAGTCTGCAGGCATTCTGGCCAGGACTTCAGGTTTTAGCTGGAGATG
TCGATCCTGCCATTCGAACACATGCTGCCTTCTTTAGCGTCTGGAAAAAATATGGGTTCACTCCAGAAGGGTTTAATCTGGCTACATCCACTGTTCAGAA
CGGACAAAGGAGCTACCCGCTGCGGCCTGAGTTGATTGAAAGCACATATTGGCTATTCAAGGCTACCAGAGATTATAGGTACCTTGATGTTGGAAGGGAT
ATACTAGCAAGCCTTCAATATGCTGCTAAATGTCCTTGCGGCTACTGCCACATTTCAGATGTGGAAACCCACAAGCAGGATGACCACATGGAGAGTTTTT
TCCTTGCAGAAACGGTAAAATATCTCTGGCTTCTTTTTGATTTAGCTGTAGGCCCTGATAACATTGTTGAAAATGGGCCATATAAATACATATTCAGCAC
AGAAGGCCATTTGTTACCTGCTACTCCCGAAATAACCTTGGTAGATGAGCATTGTCTTTATTTTGGAGACCGTGGCTACAGCAGTGGTGATGGTTCCAGT
ATACAGCAAAGTGCTAACTGTGCCCAGTTTGATGAAAGACGGACTGTTTCCAGTCAAAATTCATTGTCCAATGTTTTGTTCACAACAAGAGGTTACATCA
AGGGAGTTTGTCCAGGATTGAGTCATGCACAGAAACTTGGCATATCATACCATGGCGAAGAGGATAACACGCAGAATTCTAGAAGTCATGAGCACCCCGA
TGAATCTTATGTGGACCAATCCAGTGTCCAGATTCAATCGAGTTCTGTAATATTGATCTCTCATCCAGCCACAAGCCCACCTGATGAGCCTTTGAAAACC
AGGTCAAGAGCTCAGCACCTTGAAAATATTGTGGTAACTGGCGATTCTGAGCCAATAGAAGTTACTGATGCTACTGGTGGCTCGTCCGAAGGAAACACTG
AAATTTTTTCCGAGGTCACCTTAAGCATCTCTGAACAGATAGAAGTTACTGCTGAAGAGATTGTGACTCAGGACAATCATATTGAAGATAGTACCAGCTG
ACCATTAGAGTAGGCACCAGTTTTTACACCTAACCTGGAGCACCTTGAGAATCAACATTCATCAACAGATTTTGTTGTAGATCAAAAAGTTAATATTCTG
TTGCAGCGAACCGATATATGTTCTGTTATATGGGTTTGATCAAATAGCTGATGTAAAGTTATGTACACTAGAAGCAAAGGAACTATATGGCCAAAATGGC
ACATACCATCACAGATCAGCAATTTTACTGAGAACTTGGACCTATCTGTGCGTGCGTGAAATTTTCCTTGGATGTTTTTATTATTCATCCAAGTCGCGAG
ACGCAGTCTTCAAGGCGGGGCGAGCAAACCATCTGACGGCGAAACATCTCAGAATGGAAACGCTTAGATACAAATATCCATCTCTGGAATTACATTACAC
CGATCATGGCGATGCTCGCGAGCGGATTACATGAGACGACGAGGAAACTATGTGTAGCTTAGAGCGAGAGGCCGCCGGACTCCTCGTCCTCGTCGAGGCC
GGAGGTGTAGACGGTGTAGAGCGACCAGATGAGGCCGAAGACGCCCAGGAGGATCCACCCCAGCAGGTTGTTGCTCAGCCCCAGGCTCAGCCCGGTGCCC
TCCGTCGACATCCGCTCGTCGACCAGCGCCAGCGCCGGCCCCGCGGACGCGGTCACCGCGCCCGCCGCGGCGAGTAGGGACGCGCCAGCCCCGCGGACGG
CGGCGGCAGGGGTCGCCTCCTTGGCGTCCTTGGAGTAGCTGCACCTCACCCTCTCGCTCCTCGTCCTCAGCTGGGGCAGACCTAGGGCCTGCGGCCTGGC
GATGGCGGCACGGGCGACGACGGTGGTCGCCGCGGCGGCGCTGATGGTGGCCATTTGGTTGTTGTGCTTGCGCTGCTTGCCGCCGGCCTGCTGGTGCTGG
AGAGTGTGGCTTGCTCGGGTCTTGCCCCGG
page-top