Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig30756  (registered. 2012)
Contig Information
Length 1305 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_VSCB Liquid cultured tissue 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242056121|ref|XP_002457206.1|| hypothetical protein SORBIDRAFT_03g003300 [Sorghum bicolor]
Score 418
Evalue 7.00E-115
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig30756
TTCTTGTTTTATACAGTCAAGATACAACTCAAGTTACACACTGATGCCATGCCCAGCTCAACACAAGGGGCAAGGTCATAACAGTAACACAACAGCAACA
ACAAGCACAAACAACAAAATGACATCCCCCCCTCTCTTCAGTTAGCTTGGGTATTTGTTTTTAATTCTATGGTGTCTAAATCCTACAAAGAATGGATCGA
GAACACCTTTATATATACAAACAGAACACAGGTTGTGTGCCTGCATATGATTAAACAAGGGGCGAGGAAGTATGCATATATAGCACTGTAGTTGCTTCTT
TGGCCTGGTCAATAAAGAAAGGCCGAGCTGCCCCCCACTCCTTTTCTTTTATCAACTCCCAAAAAATCGAGTTGTAAAAAGCTATCAAAAGCACCTCTGT
TAAAACCAGATGTCACGACTGCCAGAATATGTTCGGGTCCTTGCTGTATACCGCTTGGTCTTGGATCTCTAGATTACCCACATGCCAATCAACAAGCCTT
GCTTGGATGCATTTCAACAACATGAGTCCAGTCGGAAACAGCCACCAGCCGCTTTCATCCGTTCCAAGGTTCCATGGCTGTGTGCTTGGATGTCTCTTGG
TTGACGACTTATAGTGAACGAATCCGCATATCAAAGCCACAACAACATTAACCAGTGAAGTAATGTTCCACAATGCATATACACGAGCAAGGCCTGCTGA
TCGCCGTGGTCCATGACTAAAAAGAGCATTTATTCCAGCAGGGAAAGGCGACAGTATCGCAAGAGGAAGAACAAACAGAACTAAGAGAACGTCGGCCATT
GAGTATGAGTATAGCTGGAGAAAAGTAAGCAACACTAAGCTGAAATCCGCCAGGAGCAATATTGAGATTACTAAGCCAACAAGATCCTGATGCCCAACTG
GTTTAGAATTGTGCAAGATAAGAGAAAACGGGTACAGAAAATCTCTCCTGTCTTTAAGTGTCCGTAAGGTAGTACTATCTAGAATGCCACCAGTAATCCT
TTTCCGCATAAAAACATCCTTAATCCTTGAGCGGCTTAGTTGAGCATCAGCAAGCATGTCCTGCACTAGCGAATGCTGCTCTATTTTAATTCTTGGGCTG
TCTTTGCACCCCCACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCATC
GTCTCACTGGCCGACCTTGACCCCTGTTATTTTTGGGTCATATCTAGTATTCAGAGTTTGCCTCGATTTNGTACCGCTCGCGCAGCCCGCACCCCTCGTG
CCGAA
page-top