Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3072  (registered. 2012)
Contig Information
Length 787 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242093660|ref|XP_002437320.1|| hypothetical protein SORBIDRAFT_10g024790 [Sorghum bicolor]
Score 258
Evalue 4.00E-67
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3072
CAAACATATTTAACTCAACTCAATGTACATTATTCTAGAGCAAGCTTTCTGCAGCAATGCTTTTTTTTCTGTCTGGGGTGGGCACATATATTCGTGCCAA
AAAAAGAACATACATATATTGCAAGTGGCTCAATTCGACATTGAGCCAGCTTATGTACACAAGACCTGACAATTTCAACCATCTAATTCTTCCATGTGAC
AGGTCTCAATGCTGAGTTGCTGACCAAAGAAATCATCTTTCTTCACAGCATCCCAGCAAACCATCTTCCTTCAAAGCCACTGAATTTTGTAATATGAAAC
TGCGTTTCCTGCATCAGTGACGCTCTTCCTTTGAACTTTGAAGCCTGAATTTCAGGCCACCTCTTTCCTACGGAAGATGTTCATTGCATCACTGTATAGG
GCAACAGAGTTTGAGACAACAGCAAGCACGATCATGGTTACAGCCAATATCTTGTCACGCTTGGTTGCGATTCCATAAGGATCCCTTAATATGACCATGG
CAGGAAAGATAAAACCAATCAAAACGGCAGCTGTGGCGCCAGTAAACTGGAATGCATCCCAAATGCTTGGTATGAAGATGGCAGCAGTATAAATAACCAC
GAGGAGTGAGATGGTTATGATTGTAAATCTCTTATTGTCATAAGAAATGTGCCTCGACGTGGGAAAGAGTAGACCATCCAAGTTGAGCCTAAGGGCAAAG
AAGACGATGGGGAAGACAAGCATAACGTGCGCAGCATAGCTCACTCTGACTACGTCATTGAAGACAGAGCTGAAAGGAATGCCAAGA
page-top