Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig30642  (registered. 2012)
Contig Information
Length 979 bp
Clones alternative view 26 Clones [Download: TSV  ,  FASTA ]
WH_XR Roots, 18 day old plants were grown hydroponically 14
WH_XT Roots, 18 day old plants were grown hydroponically 7
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|145353601|ref|XP_001421096.1|| Receptor of activated protein kinase C 1A, component of 40S small"
Score 424
Evalue 8.00E-117
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig30642
AAAGGACACAGAGGATGGGTTAACTCTATTGCTACCCCAGAAGAAAGCTCTGATATGATTCTTTCTGCATCTCGTGACAAAACTGTCATCATCTGGAAAA
TCACCCGTGGAGAAGGTGAAGGAGGAGCTAATTCCGAATACGGATTTGCTCGACGTGCTCTCAAAGGACACTCTCACTACGTCGAAGATGTTGTCATCTC
AAAAGATGCTCATTTTGCTCTCTCAGCCTCATGGGACCACACCATCAGATTGTGGGATTTGACCGAAGGAAAGACCAACCGACAATTTGTTGGCCACACC
AAAGATATTACCAGTGTTGCTTTTTCATCAGACAACAGACAAATCGTCTCTGGATCAAGAGATAGAACTATTCGCCTCTGGAATACCCTTGGAGAATGTA
AATTGACCATTGATGACGCTCATGCTGATTGGGTATCATGTGTCCAATTTTCACCAGTCACCAACCCAAACCCAATTGTTGTCTCTGCTGGATGGGATAA
ACTCGTCAAAGTTTGGACTCTTGGAGATGAATTCAAATTATTCAGAACTCTCAGTGGACACACTGGATACATTAACACAGTCACTGTCTCCCCTGATGGT
TCCCTCTGTGCTTCTGGAGGAAAAGACGGAACAGCAATGCTCTGGGATTTGAACGATGGAAGAATGCTCTATTCTCTCGATGCTGGAGATATCATCAACT
CTTTGGTCTTCTCTCCAAACAGATATTGGCTCTGTGCTGGAACTGACTCCGGAATTAAAATCTGGGATCTTGAATCTAAAGTCCTTGTTGCTAACTTGGA
TAAGAATGTTCCACAATTCTCTGTTAAAGGAGCAAACAACAATCCAAACCCAGGATGTACTTCTCTTGCTTGGTCATTTGATGGATCTATTCTCTATGCT
GGATACACTGATAACCTCATCCGTGTCTGGGCCACCGTCTAAAGCAATAAATCTAGTTTTTTTGGTTCCAAAAAAAAAA
page-top