Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig30612  (registered. 2012)
Contig Information
Length 767 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115461462|ref|NP_001054331.1|| Os04g0687100 [Oryza sativa (japonica cultivar-group)]
Score 396
Evalue 1.00E-108
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig30612
GGCCGCCTCCAACCGCAGCGCAGCAGGATGAGTGAAGAAGACTCGACGAGCCGGCCAGCTCCGAAGCTCAACGAGAGGATCCTTTCGTCGCTGTCGAGGA
GGGCAGTGGCCGCGCATCCGTGGCATGATCTCGAGATCGGCCCTGGGGCTCCAGCGGTGTTCAATGTTGTTGTTGAGATCACAAAGGGAAGCAAAGTGAA
ATATGAGCTTGACAAGAAAACTGGACTGATTAAGGTTGATAGAGTTCTGTACTCATCAGTTGTATATCCTCACAACTATGGTTTCATTCCGAGAACACTT
TGTGAAGACAACGATCCAATGGATGTGTTGGTCCTGATGCAGGAGCCTGTTATTCCTGGTTCTTTCCTCCGAGCTAGAGCAATTGGCCTTATGCCCATGA
TTGATCAGGGCGAAAAGGATGACAAGATCATAGCAGTCTGCGCCGATGATCCTGAATACCGTCACTACAATGACATCAGTGAGCTGTCTCCTCACCGCCT
CCAAGAGATCAAGCGCTTCTTTGAAGACTACAAGAAGAATGAGAACAAGGAGGTGGCTGTCGATGCGTTCTTACCTGCGACCACTGCCCGCGAGGCCATT
CAGTATTCGATGGACCTGTATGCGCAGTATATTCTGCAGAGCTTNNNNCAGTAGAATGTCGGCATTGTTGTATCGCGGGAATCTTCTATTAATAACGAGT
GGGGAAGAGCTGAGACTTTGTGTGTTATAAATAAATGCGCAACAATGTGTACTCGCACTATTTATGA
page-top