Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig30565  (registered. 2012)
Contig Information
Length 709 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 3
Wh_DPA20 Seed DPA20 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115473523|ref|NP_001060360.1|| Os07g0631100 [Oryza sativa (japonica cultivar-group)]
Score 176
Evalue 3.00E-42
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig30565
AACAGCCTCACAAACATCATGTCTCAAGTACACATTCTTTGCAGGTACCGAGATTAGGTGTAATCTCAGCCGCTATACCAAGGTTTACAAATACAGGTAC
ACAATATCATCGGTTGTGTATTAAGCACGGGACAAACTGCCTACTAACGTTTAAGTCAGCCAGTACATTGTTACAATGCTACTACAGATATGGCTGACAG
TGGCAGTAAATGACATCAACACATTGAGATCATAGAGTATTATAGTTACACTTGCTCATGCACCATCGTCATCTTCAACAGTGTTGACACGCTCGCACTC
ATCGATCCATTCGCTGTATACATCAATAGCTTCAGTGAGCGCATTTGCAGTGGTGCTGAAGCTTTCCTGGCAGATTTGACAATTGGCCTCACCAATCAGA
TTCTTCAGATCGATCCGGCATTCAACGCTGCTCCCATGGTTGCAGAATGGGCAGGAAAAGACGGTATCGAGCTTGTCCATCCGCTTCCTAGGGGGTGGCT
TAGCGGCCGCCTTCCTCTTCCCCATGGTTCGGCTTCTGTCCTTCCTTCAAAATCTCAGACTCAGAGGGAGGGAGGAGATCCGGTGGCCGGACGAAGACTG
GGACGGGGTGGAGTCAGCCGCAGGACGCCCCGGGGCCCGAGTAAGAAGGACTGCGCAAGGTCGCCGAGAGGCGGGATCGAGGCGGCGGCAGGTAGATCCG
CTGCCCGGG
page-top