Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig30558  (registered. 2012)
Contig Information
Length 1986 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218196017|gb|EEC78444.1|| hypothetical protein OsI_18294 [Oryza sativa Indica Group]
Score 927
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig30558
CAGAATCAGTTCACTCTACCTGTACATAGCCAGAGGGCGAATACATCCGTCCGTGCCGTGGAGCGAGGCCGCCCGGCCATGACGACGTACAGGGTGTGCT
GCTTCCTGCGGCGGTTCCGGCCGGCGTCCAACGAGCCGTCGGAGGCCATCGGCGACGTGTTCGAGGCGTACGCCGGCGCCGACGGCGGCAGCGGCGCGCT
CGGGGAGGAGGCGCTCAGGAGGTTCCTCCGGGAGGTGCAGGGGGAGGCCGGCGACGACGACGTCGAGGCGGCGGCGAGGGAGGTCCTGGCCTTCGCGGCG
GAGCACCGGCTGCTCAAGAAGGGCGGCGGGCTCACCGTCGAGGGCTTCCACCGGTGGCTCTGCAGCGACGCCAACGCCGCCCTCAATCCTCGCCGTGGGG
TTCACGATGACATGGGGCTGCCGCTGTCGCACTACTTCATCTACACGGGCCACAACTCGTACCTGACCGGGAACCAGCTGAGCAGCGGGTGCAGCGAGGC
GCCCATCGCCAAGGCCCTCCGCGACGGCGTCAGGGTCATCGAGCTCGACCTCTGGCCCAACGCCGCCAAGGACGACGTCGAGGTCCTCCACGGCAGGACA
TGGACGTCGCCGGTGGACCTAATGAAATGCCTGGAGACCGTCAAGGAGCACGCCTTCGTCTCCTCCCCATACCCCGTTATCCTCACCCTCGAAGATCACC
TCACTCCGCATCTTCAAGCCAAAGTAGCAAAGATGATCAAGGAGACATTTGGGGACTTGCTCCACCTCTCGGAGTCCGAGGCAATGCCCGTATTCCCTTC
CCCCGAGGACCTCAGGGGCAAGATCATCATATCAACCAAACCGCCAAAAGAGTACCTTGAAACCAAGAGTAGCAAGGAGGAGGCCCAAAATGGTAGCGCG
GAGGAGAGTGTGTGGGGGGACGAGATTCCCGACAACAAGGCTCAGGTTGCTACTGCTCGCCAGGTTTCAGAGAAGGACAACTACCGGTATGTGGAAGAGG
ATGAAGAGATGGAGAAGAAGGTACAACTGGGGGTTAACGGGGAGTATAAAAGTCTCATCTCAATCAGCCTCACCCGGAGAAAGCACGACATGGATCAGGA
TCTCAAGGTTGATCCCGAGAAAGTGTCTCGGATGAGCTTGGGGGAGGCGGCATACGAGAAGGCCACCATTACTCATGGATCTGAAATTATAAAGTTTACA
CAGAGGAACTTGCTACGGATTTTCCCAAAGACAACGCGCATTACTTCATCCAATTACAATCCACTGATGGGATGGAGATATGGAGCTCAGATGGTTGCAG
CAAACATGCAGGGCCATGGAAGGAAACTATGGCTGACTCAAGGGATGTTCCGGGCAAATGGCGGTTGTGGTTATGTGAAAAAGCCTGATTTTCTTATGAA
CACGGATAAAATGTTTGACCCTAGATCCAAACTACCAGTGAAGACAAGGCTCAAGGTGACTGTCTACATGGGAGACGGATGGCGATTCGACTTCCGCAAG
ACGCATTTCGACAAGTGCTCGCCACCAGACTTTTATGCAAGGGTGGGTATAGCAGGAGTGGTTGCAGACACAATGATGAAGGAGACCAAGGTGATCATGG
ACAACTGGATACCGACGTGGGACCACGAGTTCGAGTTCCCGCTGTCCGTGCCAGAGCTCGCGTTGCTGCGCGTCGAGGTGCACGAGTCCGACAACCACCA
GAAGGACGACTTCGCCGGCCAGACCTGCCTGCCGGTGTGGGAGCTCCGGTCTGGGATACGCTCCGTCAGGCTCTACGCCCGCGACGGCGAGGCGCTGCGC
TCGGTAAAGCTGCTTATGCGCTTCGAGTTTTCATAGAGGATCGAGCTCGCGGGCGTTTCCCTGTTGATCCTGGCGATGCTGGTGGTGTGTGTAAAAAGAT
TGGAAATTTTTGTTCGTTGGTGCCTCTGTCATTGTGCGCGTGCTCGTGCTGTATATGATGTGATTAGAACTCAATGTGCGACTATT
page-top