Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig30536  (registered. 2012)
Contig Information
Length 1203 bp
Clones alternative view 35 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 2
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 3
Wh_SHDr Shoot grown with dessication 1
Wh_VSCB Liquid cultured tissue 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 3
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 8
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242036039|ref|XP_002465414.1|| hypothetical protein SORBIDRAFT_01g038360 [Sorghum bicolor]
Score 690
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig30536
CGATGGCCACAGCTCACAAGTAACTAGTAGGCACAAAACTAAGAACATAACAGAAGAGCAAAGATAAACTGTTCAACATTATTTGATGGCAACGTGCTGC
TGGATGCGACTACTAGTGATGCAGGCGTGCTTGGTCTACTGGGGGTTGGGTGGCCTGGAGTTGGCAGCAGAGACCCTGGAGCCCCATTCCAGAAGCTCTT
TGCTGGTGTCGTCCTTGTGCGCGATCACCTCGATGAAGCACAGAGAGTCCTTCTTCTCCCCCAGCGCCGTCTCTATCGCCGCCGTCAGCTCCTCCTCGCA
CTTCACCTTGGCAGTCCAGCATTTGCCCTCCCCGTTGTGGATGGCCTCCACAAGGGCGGTGTAGTTCCAGTTCTTGATGACATTGTAAGGCCCGTCGTGG
ATCTCCACCTCGATCGTGTACCCGCCATTGTTGATCAGGAAGATTATGCTGTTCTGTTCGCACCGCAGCATAGTTGACACATCCTGTGCTGTCACCTGGA
AGCTCCCATCACCAATGCAGGCTATGACACGCTTGTCACTCGCCCCTTGCGCGTACCCGAGCAATGCACCCACTGACCATCCAATCGAGCCATACTGCAT
TTGGAATTCATACCCGCAGCCCTCGGGCAGCTTGAGCTTCTGGCAGTTGAACCAGGAGTCACCGGTCTCAGCGAGCACTGCACTATCACCCGTCAGCATG
TCCTGGATGTGCTTGAAGAGCACATTGACACGCAGCGGCTCGTTCGCCTCGCCCTTCAGCGGATGGCCCTCAGGCACGAAGATCCTCTTGTAGTTCTCGT
AGGCGGTGGTGTTCTTCTGAACCCGCTTGGCCAATGCAGACAGGTACTCCTTCATCATGACGCAGCCGAATGCCGGGCCGTTCCCGACGATGACACGCTC
AGGCTGCACGATGATGGCCTTGTCCTTCTTGAGCAGGAACGAGTAGCCAACAGAGCTGTAGTCGTTGAAGATGGGGCCTGCGAAGAGGTAGGCGTCGGCC
GACTCGACGATCTCGGCGCAGAAGGCCGTGCTGACGGCGCCCCAGTAGGTGCCGAGGAAGTGGGGGTGCGTCTCTGGCACAAAGCCCTTGGCCGATGGCA
TTATAGCATAGGCATAGCCACTGGCGTCCACAAGGTCGACGAAGGCCTTCCCCGCCTTGGCCACGCGCAGTTTGGGGCCGGCGACAAGCACTGGCTTCAC
CGC
page-top