Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig30497  (registered. 2012)
Contig Information
Length 686 bp
Clones alternative view 160 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 9
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_VWD Shoot grown with dessication 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 9
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 7
WH_XN Leaves, plant was grown at constant 23 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 11
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 6
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 8
WH_XR Roots, 18 day old plants were grown hydroponically 16
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 21
WH_XT Roots, 18 day old plants were grown hydroponically 8
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 28
WH_XA Root 5
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 4
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 11
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|170791|gb|AAA50848.1|| wali3 [Triticum aestivum]
Score 182
Evalue 2.00E-44
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig30497
TTTTTTTTTTTTTTTTTGACACAAATAAACTGATTTTTATTTGATTGAGCAGAGACGCATACACTGATACTGTGATACATATTTATGTGATTTATTCACG
GAGCAGCGACAACAGCTTTTTCTGGAGAGAGAGAGAAAAGCATAACGACGACGATGATAACAACAATTGTTGTTGGGCGTGGAACACGTGCACGTACAGC
CATAACGGCTCTGCTCAACTCATCCCAGCTTTTATTTTCGGCGCAACATCTGATGTTCTGAGCATGAGCGATCAGTACTTCTTGCAGGGCTTGCAGGGCG
TGCCATCGTCGACGCGTGCATCGGCGCATCGGAACGTCTTCTTAGGGCTCGTCTGCACGACGCGGCAGTTCACGCAGCCGTCGCGGCACTTGGGGCCGGC
GTCGTCGCAGACCACGGCCCCCGAGAAGAACCTGCAGCTGTCGCAGCACTTTGGGAACTCGGCGTTGGCCTGTGAGAGGATCCCCATGACCAGGACGGCC
TGGAGAACCAGGATGACCACGAGTGTGCTACTCTTCATCGTTGCTCCTAAACTTCTCTACAGGGAAGCTCTGCACTGTCCCGTCTGCTCGTGGAATGATG
GTTTATGCCCGGGACGGACCAGTGACCTTTGAGCAGCCAAAGATGACAGTCGAGAAGCTGCTAGAGTACGGGCACATGCTCGTCCA
page-top