Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig30474  (registered. 2012)
Contig Information
Length 733 bp
Clones alternative view 43 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 5
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 6
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHC Shoot grown with cold treatment 3
Wh_VSCB Liquid cultured tissue 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 4
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_CA 1
WH_SP 2
WH_XA Root 2
WH_XB Root 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|122044864|sp|P05621.2|H2B2_WHEAT|H2B2_WHEAT RecName: Full=Histone H2B.2
Score 285
Evalue 4.00E-75
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig30474
TTTTTTTTTTGATAAAAAGATAACTTCAGTTCTAGATAGATTTCATCAGTATGCCAAAGCAGCAACTTCAGTTCTTACAACCAACGGGCCAACAAAGCGT
TGGCAATCACCCAGCACAGGTGCTACTACTGCTACCACTACTTGCGGATAGATAGATAAGCAGAGTCAACAGTACAGATGCAGATGCAGAAACCAACTGC
ACGCCGTCAGTCTAGGAGGAGGTGAACTTGGTGACGGCCTTGGTGCCCTCGGAGACGGCGTGCTTGGCGAGCTCCCCGGGGAGGACGAGGCGGACGGAGG
TCTGGATCTCCCTGGAGGTGATGGTGGGCTTCTTGTTGTACCTCGCGAGCTTGGCCGACTCGCCGGCGAGCTTCTCGAAGATGTCGTTGATGAAGGAGTT
CATGATGGACATGGCCTTGGAGGAGATGCCGATGTCGGGGTGCACCTGCTTCAGCACCTTGAAGATGTAGATCTTGTACGTCTCCACGCCCTTCTTGGCC
TTGCTGCCCTTCTTCCTGCCCCGGGTCTTGGCCTCGCCGCCGGCCTCCTTGGACGCCGTCTTGCCCGCCGGCAGCCGCTTCTCGGCCTTGGGCTTCTTCC
CCGCGGGGGTCTTCTCCGCCGCCTTCTCGACCTTGTTCTCGGCCGCCGGCTTCTTGTCTGCCTTGGGGGCCATGGCTGCTGCTTCGGGTGGGGTTGGGGG
CTGCGGTGGTGTGGGTTGTGTGAGTTTGCTCGA
page-top