Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3045  (registered. 2012)
Contig Information
Length 1065 bp
Clones alternative view 37 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XN Leaves, plant was grown at constant 23Ž 7
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XF Seedling, infected with leaf rust 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23Ž 3
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|271278029|emb|CBI69999.1|| putative salt-stress root protein [Lolium perenne]
Score 339
Evalue 3.00E-91
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3045
CGAGAGGAACTACGCATCCATCCCTTCCGCCCCCAGCTACCTCGCTTGCTCCACGCGTCGTCTTTGAAGGAGAGGAAGATGACGAGCGTATGGAAGACCA
AGGTTCTTCCCGGGCTCAACAAGATCTTCGACAAGGATGGCAAGAAGGCCGCCGCCGCCGAGTTCTTGAAATCCTTCAACAAGGAGGAGATTGACAAGGA
GATTGGGGACAAGAAGACAGAACTAGAGCCCAAGCTTGTAGAGACTATTGAAGCATCTCCTCCAGAAATTAAGGGATTGATAAAGGATAAGAAAACATCC
AAGATCAAGAAGAACTCGGTTGCCGTCACCAAGTTCCTTGACGATTTGGCCAAGATTGATTTCCCCGGTGCCAAGCTGGTGAGCGACGCGGTGGCCAAGT
CCGGCACCACGCCCCTCTCCCCGGCCATCGTCTTCATCTTGGACAAGGTTGCGCCTTTCGTCCCCGCGCCCAAGGAGGAGCCCAAGGCCGAGCCCGAGGC
CGCCGCCCCGGCAGAGGAGACCACCACCCGCGAGGTCGCCGTGGAGGAGAAGGAGGAGGAGGCCGAGCCCTCCGCCGCACCGGCAGAAGCCGCGCCGGTG
GAGGCAGCCGCGCCTGCTGCTGAGGTAGTGGAGGAGAAGAAAGAGGAGGAGAAACCCGCCGAAGCCGCCGCACCTGCCGCCGAGGAGCCAGAGAAGAAGT
GATCGGTCGCCGCCGGCCGGAGTCCAAGAGCAACCCAAACCACCACCTGGCTTGCTAGCTGCTGGTAATGGAAGAAATCATTTTAAGTTATTGTGAATTT
GTAGTCGCTCTCCGTGTCAAGGTAGCTGCACAAAAGTAAGCACGTACGTACGACACACTGCACTTGCCATGCATACCACGCATGCAAACGTACACGCATG
GAACATTTGTTATTCTTTCGATGGACCGGTCTCCTCACCGTATGTGTACATTTTACGTGGGGCTTTCTTGCTTTTTTGTGGTGATTAAAACCTGTGTAAT
TATGATTATGTTGGTGTGTTAATTTGTTGGTCATGGTATAAGCAAAAACTTGTGCAAAAAAAAAA
page-top