Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig30431  (registered. 2012)
Contig Information
Length 1085 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
WH_XT Roots, 18 day old plants were grown hydroponically 9
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|295882012|gb|ADG56719.1|| heme oxygenase 1 [Triticum aestivum]
Score 393
Evalue 2.00E-107
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig30431
TTGTGCTCGTTTCTTTGATCTTCCAGTCTTTGCTTTCCGTTTCNNNATCGTCGACTCCATGGCGCTCGCAGCAGCAACCCTTGCCTCCTCTCCGCGCGTA
TCTACCTCCGTTTCCGCCGCTGGGATGAACAGCAGCGGCCTGTCCGTGTCGTTGGGGGCGCGCCGTGTGCCGGGGATTTCTGTGCAAATTATTCATTCCC
AAAGGAGGAGGATGGTCGCAGCGGCGGCAGTGGCGAGAGGGGACGAAGGGGCCGGTAAGACCTTCGTGGAGGAGATGAGGGCAGCGGCGATGCGGATGCA
CACCAAGGACCAGACCAGCGAAGGGGAGAAGGAGCTCGAGGGACCGTCGCTCAACGAGCTGGAGCCTAACCTTGAGGCCTACCTGCGCTTCCTCGTCGAC
AGCAAGCTCATCTTCCAGACACTCGAGAACATCGTCGACCGCGCTGCCGTCCCATGGTATGCGGAGTTTCGGAATACTGGGTTAGAGAGATCAGAGGCAC
TGAAGAAAGATCTGAAATGGTTCAGCGAACAGGGTCACACAATTCCAGAACCATCTGCTGCTGACACTAAATATGCTTCCTATCTGGAAGAGTTGTCTGA
GAAGGACCAGCAAGCATTTTTCTGTCACTTCTATAATATGTACTTTGGTCAATCTGCTGGAGGTCGACTGACCGGCAAAAAGATTGCTGACAAGATTCTG
AACAAGAAAGAGCTGGAATTCTACAAGTGGGAAGGTACCCTGTCCGAGCTGCTGCAGAATGTCCGCACAAAACTTAACCAAGTTGCTTCTAGCTGGACCC
GGGAAGAGAAGAACCGCTGCCTGGAGGAGACTGTGACGTCGTTCGCCTATTCAGTAGATCGTCTGCGCAAGATATTCACCTGAGCTGGAACTTAGGTTGT
ATCATTTTCTTGCCAGCTGTATCAGATCATCGGACCGGATCGTAGTACCACGATACCATGCGATTTTCACTTTTAGTATTGTCAATCTATATATTGAAAA
ATTCATATATTTGCAGTATCTCCCCACATGCCATATCTCCTTCGTNNNNNNNGGTCAATGTTATGGGTTTGTATTTTTATATTCA
page-top