Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig30346  (registered. 2012)
Contig Information
Length 1364 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242037343|ref|XP_002466066.1|| hypothetical protein SORBIDRAFT_01g000600 [Sorghum bicolor]
Score 467
Evalue 1.00E-129
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig30346
CAGCCAGAGAGAAATCAAACGGCAGTTCAACATAAAATGAGGTTTGCAATTGTACACCCCACTGACTCCACCCGGGCCACACATGACTCTTGACTCATGC
TCGATTGATTGATTTTTCCTCTAAATCCTTCTTCCATGGTTGCATGGCTGCCAATGTTGAGCAAAAACAAGACATGGTGACACTTGAACCGGACCATCAT
CATCTTCCCCCTCTCCTCTTTCATGCTGAAAAAGGAAAGGGTCTCTCGCTAGTAAACTAGGCACAGAACGGACCGACACCGACCAACGCAGACAGACAGA
CGGCCATCTCTGGCTCCTTGGAGACTAATCTCGCCAAGCAGCGGAATCAATCCAATAAAATTTAAAGAGAAAAAAGTCACCAGGTAGTTTCGGTTACGAC
AGACGGACAGACGGACGGTGAGGGTTGGGTTGGCACAACGAAAGGAAAAAAAAACTTTACAATCTGTTTTGCTACTCTTGTCCAAGAGCAAGCCAGAGAG
AGAACTCCATGTTGGCTCCACAATCTCTTTCTTGCATGCTAGCTCTTCTGGCACCACTTGCCCGGGAACCAACGAAAACAGGGCTCTCGCTAGCTCAGCA
GCAACTTGAATATGTCGCTCAGCGATATTACGCCTTCCACTCGCTTGCTGCCAGCCTCCACGATGAACACGCGACGCACCCCAGGATTAGCCAACCTCTC
CATAACCTTCAGCAAAGGGTCAGACCGGAGACACATCTGGCATCTTTGACCGTTGAAAAGTCCGAAAGGTGAATTCGCGTCTTGCCCAAGCTGCAAGGCC
TGATGAATGGTCATCTCATCTAGGCGAATATGGGTGTAGACCTTGTCTTTTGCTAGAGCTGTGATGTCACTTCTGGAGTATGTGTCGATCAGCGAGTCGT
TATCATCCACAATGGGTATTGAACTAACTCCAGCTTGAACCAACAAGTTAAGGGCAGAGCTAAGAGATGTATTAGGCCGCAACATAGCCAATGGATGACC
ATTTGGTTCACCAATTTTTGGAACCCATGTACCCAGCGGAATTGAGCATACTGGTTGGTTTAGAATCGGTAAACTACCAGTGGAGTTCTTGAAGTATCTA
CAGATACATTTCAAAATTCCTGAAAGGGATGCAAGATGCAACAGCTGCGGAAACGATCCATCTGTTGACGATGAATAGATGATTGGCACTGTAGAAATAC
CAGTTTCGAGTATTTTCATGGCAATACCCCTCAATGATTCATAAGGGGTGGCATGCACTAGATGCNNNTTTGATCTAAGTTGTCCGTCATTTCTTCCATA
AGTTTGCCGCTTAGCCTCTTTCCACGCAGATATAGTGTGTGTTTCAAGCTGTTCCTCTGTCAGG
page-top