Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig30329  (registered. 2012)
Contig Information
Length 1001 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222625574|gb|EEE59706.1|| hypothetical protein OsJ_12133 [Oryza sativa Japonica Group]
Score 345
Evalue 4.00E-93
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig30329
TTTTTTTTTTGAAATCAAAAGTGGACCTAAACCAATTTTTATAAAGTTCACACTAACATTACATACCACAACAAATGACTGCAAAAAATCACATTCATCG
TAACCATAAAAAATCACCTACAGAATTGTAGGCATCAGTTCTGAAACCACACAAACAGACCAACATTCCCATCAGTCAGAAATGTCATCAAAATCCAGCT
AAAAACTCCCCACAGAAACAAGGGTAAGACATCTAAATCTTTCCTGGGCAGAAGCAACCAATCAATCCAATGCCCATGAATCAGAACTAGCGTATGGTTC
CCTAGCTTCTACTGCTAATAATGCACAATCATTACAAAATACGCTTCCTAGGTTGCACAAGGCCGAGCACCGTCCATCCGTTATATGTACCTTCGAGGCG
TTTCCAGATTTTCCCCGTAAATCAGGTGCTCGGGGGAGCTGAACTGGGTATCTTGAAATGTTTCTTTACATAGTGTGATGCCTCAGAATCATTTCTGTGG
CACAGGACCCTCAGCAGGGTTTTGGAGTCACTTCCGAATTTGCTTTTGCCCCCTTGAGTAACTTCGCGCAGATCATCAATAAGCACACGGGTCTCTTGCT
TGATCAGATTTATTACAGGACGAACACGCGAGACCAAATTCTCAACAGTTCCACGAGGCAGCCCATCTCCGCCAGATATGAAGAATTCCTTAAGAATTTC
AAGATCTTCCTCCAAAAGAGGGGCATCATTTGGAGAGAAGACGCGTGTAGGACCTCCATCTAGTATTACCCGAACTAAGCCATCCAGGGATGCTTGCAGA
AGCCCTGTAACAACACGATCTCGCAGTTGCTCCACAATGACGTCACAGAGTTGAGCAAGCACCAAATCAAGCACTTCGACAATAGTGTCCAATCGAGCTT
GCGAAACACTGTTTTTGTACATATTGTCGATGAATGGCTGTTGGAGGTCCCAAAATATGACCTTTAACCCTGTAAATTCACATACCCGATCAATAGCAGC
A
page-top