Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig30301  (registered. 2012)
Contig Information
Length 811 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 2
WH_XB Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115446033|ref|NP_001046796.1|| Os02g0461900 [Oryza sativa (japonica cultivar-group)]
Score 271
Evalue 8.00E-71
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig30301
GGGATCCTCGCCTGCGCCTTCGCCTTCGCCTTCAACTTCGCCGCCGATGCCCATGATAGGGAGGGCCGGCAACCTCACCGTCTTCATCACGCCGCCGTCG
CCGGCCAGCACCCCGCGCTCCTCGCGCCCGTCCGACTCCCCAAGGCCGGACTTCTCCACCCCTAACTCCCGCACGGGCACGGCACCGCCTCCGCCGCAGA
AGAGCGCTAGCCCACCCGCGCCGCCGGTCAAGTTCTCGTCCCCTCCACCACCCGTGAAGGTGTCCCTGCCTCCTGTGCAGGTGCCCCCGCCGCAGTACGG
AAAGGCTTCTGCGGGGGGCAAGCACGACGGATCGGCGTTCGGCTTCTTATGGGACGCCGTTGCGCGCGTGCAGGAAGCGCACACGAGCCTGGACGAGTAC
GTCGCCAACTGGTTCGGATTGGATCAGTCCAAGTACCAGTGGGCTCTCAACGACTACTACGATACCACCGGCAAGGAAGTGGAATATGGCAAAGCTGGGA
AGCCAAAGGAGCTTACTACTACTACTACTACTACTAAAGTGCAGAAAGTTTAGAAGCAACTTCATTTCAGGTTGTGTGTGTAGTGAAGCGAAGTTCTATT
TGTTAGATCTTGTCATTGGGGCTTCAAGAGTTTTTGCCTCTTTATCTACCTGATGAAGTAGGATCTACATTTGACACAAGGGGTACTTGGATCATGGAGA
GTCTGAAGTTATTGTTTTTTGTTGGCTCCTTTCAGGGACTGCTGTAATCTGAGACGCAAATTGCGTATTTGCAGTGGCTAAATGTTGCAGTTCAACATCT
TAAAAAAAAAA
page-top